ID: 1023648267

View in Genome Browser
Species Human (GRCh38)
Location 7:42341959-42341981
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023648260_1023648267 3 Left 1023648260 7:42341933-42341955 CCTAAGCAATGAGGACAAATGAG No data
Right 1023648267 7:42341959-42341981 GGGACAGAGGGCCCCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023648267 Original CRISPR GGGACAGAGGGCCCCCAAAA GGG Intergenic
No off target data available for this crispr