ID: 1023652912

View in Genome Browser
Species Human (GRCh38)
Location 7:42389747-42389769
Sequence CTACTGTACTAGAGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023652912_1023652914 2 Left 1023652912 7:42389747-42389769 CCATCTTTCCTCTAGTACAGTAG No data
Right 1023652914 7:42389772-42389794 ATACGAAATCAGTCTTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023652912 Original CRISPR CTACTGTACTAGAGGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr