ID: 1023653849

View in Genome Browser
Species Human (GRCh38)
Location 7:42399951-42399973
Sequence CGTTGTGGAAACATGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023653849_1023653854 29 Left 1023653849 7:42399951-42399973 CCTAACTCCATGTTTCCACAACG No data
Right 1023653854 7:42400003-42400025 ATCTGAGAACTCCAAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023653849 Original CRISPR CGTTGTGGAAACATGGAGTT AGG (reversed) Intergenic
No off target data available for this crispr