ID: 1023656775

View in Genome Browser
Species Human (GRCh38)
Location 7:42431025-42431047
Sequence GAGCACTTAAAAAGAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023656772_1023656775 21 Left 1023656772 7:42430981-42431003 CCAATATGATATTTGACATTTAA No data
Right 1023656775 7:42431025-42431047 GAGCACTTAAAAAGAATGGATGG No data
1023656770_1023656775 23 Left 1023656770 7:42430979-42431001 CCCCAATATGATATTTGACATTT No data
Right 1023656775 7:42431025-42431047 GAGCACTTAAAAAGAATGGATGG No data
1023656771_1023656775 22 Left 1023656771 7:42430980-42431002 CCCAATATGATATTTGACATTTA No data
Right 1023656775 7:42431025-42431047 GAGCACTTAAAAAGAATGGATGG No data
1023656773_1023656775 -4 Left 1023656773 7:42431006-42431028 CCATCAAATAAAGTATAATGAGC No data
Right 1023656775 7:42431025-42431047 GAGCACTTAAAAAGAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023656775 Original CRISPR GAGCACTTAAAAAGAATGGA TGG Intergenic
No off target data available for this crispr