ID: 1023660413

View in Genome Browser
Species Human (GRCh38)
Location 7:42466021-42466043
Sequence CTTCTCTGCCTGGCATTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023660413_1023660419 2 Left 1023660413 7:42466021-42466043 CCACTGAATGCCAGGCAGAGAAG No data
Right 1023660419 7:42466046-42466068 TGAAATAGGGTATAGGTATATGG No data
1023660413_1023660418 -5 Left 1023660413 7:42466021-42466043 CCACTGAATGCCAGGCAGAGAAG No data
Right 1023660418 7:42466039-42466061 AGAAGGATGAAATAGGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023660413 Original CRISPR CTTCTCTGCCTGGCATTCAG TGG (reversed) Intergenic
No off target data available for this crispr