ID: 1023661253

View in Genome Browser
Species Human (GRCh38)
Location 7:42473199-42473221
Sequence TGGAAAGTCTTGGGAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023661247_1023661253 7 Left 1023661247 7:42473169-42473191 CCCGGCTGTGAGAATTTCAGTGC No data
Right 1023661253 7:42473199-42473221 TGGAAAGTCTTGGGAAAACCAGG No data
1023661246_1023661253 8 Left 1023661246 7:42473168-42473190 CCCCGGCTGTGAGAATTTCAGTG No data
Right 1023661253 7:42473199-42473221 TGGAAAGTCTTGGGAAAACCAGG No data
1023661248_1023661253 6 Left 1023661248 7:42473170-42473192 CCGGCTGTGAGAATTTCAGTGCA No data
Right 1023661253 7:42473199-42473221 TGGAAAGTCTTGGGAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023661253 Original CRISPR TGGAAAGTCTTGGGAAAACC AGG Intergenic
No off target data available for this crispr