ID: 1023670407

View in Genome Browser
Species Human (GRCh38)
Location 7:42570450-42570472
Sequence ATCTAGGCACAGAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023670403_1023670407 20 Left 1023670403 7:42570407-42570429 CCAGACAGGATACAGGCACATGG No data
Right 1023670407 7:42570450-42570472 ATCTAGGCACAGAATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023670407 Original CRISPR ATCTAGGCACAGAATGATGA TGG Intergenic
No off target data available for this crispr