ID: 1023674944

View in Genome Browser
Species Human (GRCh38)
Location 7:42619191-42619213
Sequence TTAAAATCAAGACTAAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023674944_1023674946 19 Left 1023674944 7:42619191-42619213 CCAAACCTTAGTCTTGATTTTAA No data
Right 1023674946 7:42619233-42619255 ATAATCCATTCCTTTTCGCAAGG No data
1023674944_1023674947 20 Left 1023674944 7:42619191-42619213 CCAAACCTTAGTCTTGATTTTAA No data
Right 1023674947 7:42619234-42619256 TAATCCATTCCTTTTCGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023674944 Original CRISPR TTAAAATCAAGACTAAGGTT TGG (reversed) Intergenic
No off target data available for this crispr