ID: 1023676217

View in Genome Browser
Species Human (GRCh38)
Location 7:42632922-42632944
Sequence GTAGAATAGCAAGAAAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023676216_1023676217 14 Left 1023676216 7:42632885-42632907 CCACGTGGAAAGGAAAAATAGAA No data
Right 1023676217 7:42632922-42632944 GTAGAATAGCAAGAAAACATTGG No data
1023676215_1023676217 15 Left 1023676215 7:42632884-42632906 CCCACGTGGAAAGGAAAAATAGA No data
Right 1023676217 7:42632922-42632944 GTAGAATAGCAAGAAAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023676217 Original CRISPR GTAGAATAGCAAGAAAACAT TGG Intergenic
No off target data available for this crispr