ID: 1023684594

View in Genome Browser
Species Human (GRCh38)
Location 7:42721408-42721430
Sequence CGGCTCCTCTCTTGTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023684594_1023684603 24 Left 1023684594 7:42721408-42721430 CCTGGAGAACAAGAGAGGAGCCG No data
Right 1023684603 7:42721455-42721477 TTGTGATTTCAATTACAGGGAGG No data
1023684594_1023684601 20 Left 1023684594 7:42721408-42721430 CCTGGAGAACAAGAGAGGAGCCG No data
Right 1023684601 7:42721451-42721473 GATCTTGTGATTTCAATTACAGG No data
1023684594_1023684602 21 Left 1023684594 7:42721408-42721430 CCTGGAGAACAAGAGAGGAGCCG No data
Right 1023684602 7:42721452-42721474 ATCTTGTGATTTCAATTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023684594 Original CRISPR CGGCTCCTCTCTTGTTCTCC AGG (reversed) Intergenic
No off target data available for this crispr