ID: 1023688344

View in Genome Browser
Species Human (GRCh38)
Location 7:42760260-42760282
Sequence GCTCCCACTCTTAGGACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023688344_1023688349 12 Left 1023688344 7:42760260-42760282 CCCCATGTCCTAAGAGTGGGAGC No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023688344 Original CRISPR GCTCCCACTCTTAGGACATG GGG (reversed) Intergenic
No off target data available for this crispr