ID: 1023688349

View in Genome Browser
Species Human (GRCh38)
Location 7:42760295-42760317
Sequence TTACTACCTTTATGTCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023688339_1023688349 20 Left 1023688339 7:42760252-42760274 CCCTGGGCCCCCATGTCCTAAGA No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688340_1023688349 19 Left 1023688340 7:42760253-42760275 CCTGGGCCCCCATGTCCTAAGAG No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688346_1023688349 10 Left 1023688346 7:42760262-42760284 CCATGTCCTAAGAGTGGGAGCTG No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688345_1023688349 11 Left 1023688345 7:42760261-42760283 CCCATGTCCTAAGAGTGGGAGCT No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688344_1023688349 12 Left 1023688344 7:42760260-42760282 CCCCATGTCCTAAGAGTGGGAGC No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688347_1023688349 4 Left 1023688347 7:42760268-42760290 CCTAAGAGTGGGAGCTGCTTCCT No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688343_1023688349 13 Left 1023688343 7:42760259-42760281 CCCCCATGTCCTAAGAGTGGGAG No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data
1023688338_1023688349 26 Left 1023688338 7:42760246-42760268 CCACTTCCCTGGGCCCCCATGTC No data
Right 1023688349 7:42760295-42760317 TTACTACCTTTATGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023688349 Original CRISPR TTACTACCTTTATGTCATCT TGG Intergenic
No off target data available for this crispr