ID: 1023694339

View in Genome Browser
Species Human (GRCh38)
Location 7:42829340-42829362
Sequence GTCTTACAGCATCACTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023694339_1023694341 0 Left 1023694339 7:42829340-42829362 CCTTCACAGTGATGCTGTAAGAC No data
Right 1023694341 7:42829363-42829385 AGGTATTATTCTCATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023694339 Original CRISPR GTCTTACAGCATCACTGTGA AGG (reversed) Intergenic
No off target data available for this crispr