ID: 1023694341

View in Genome Browser
Species Human (GRCh38)
Location 7:42829363-42829385
Sequence AGGTATTATTCTCATTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023694338_1023694341 1 Left 1023694338 7:42829339-42829361 CCCTTCACAGTGATGCTGTAAGA No data
Right 1023694341 7:42829363-42829385 AGGTATTATTCTCATTTTAAAGG No data
1023694336_1023694341 6 Left 1023694336 7:42829334-42829356 CCTTCCCCTTCACAGTGATGCTG No data
Right 1023694341 7:42829363-42829385 AGGTATTATTCTCATTTTAAAGG No data
1023694337_1023694341 2 Left 1023694337 7:42829338-42829360 CCCCTTCACAGTGATGCTGTAAG No data
Right 1023694341 7:42829363-42829385 AGGTATTATTCTCATTTTAAAGG No data
1023694339_1023694341 0 Left 1023694339 7:42829340-42829362 CCTTCACAGTGATGCTGTAAGAC No data
Right 1023694341 7:42829363-42829385 AGGTATTATTCTCATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023694341 Original CRISPR AGGTATTATTCTCATTTTAA AGG Intergenic
No off target data available for this crispr