ID: 1023694636

View in Genome Browser
Species Human (GRCh38)
Location 7:42832129-42832151
Sequence CAGAGTGAATTGTAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023694636_1023694639 22 Left 1023694636 7:42832129-42832151 CCTCCATCCTACAATTCACTCTG No data
Right 1023694639 7:42832174-42832196 TATACTCTCAAAGTTTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023694636 Original CRISPR CAGAGTGAATTGTAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr