ID: 1023699293

View in Genome Browser
Species Human (GRCh38)
Location 7:42876556-42876578
Sequence GCCACGATCTGTGTGATCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023699293_1023699297 -1 Left 1023699293 7:42876556-42876578 CCCCGGATCACACAGATCGTGGC No data
Right 1023699297 7:42876578-42876600 CAAAACTAACAATCAAATTAGGG No data
1023699293_1023699296 -2 Left 1023699293 7:42876556-42876578 CCCCGGATCACACAGATCGTGGC No data
Right 1023699296 7:42876577-42876599 GCAAAACTAACAATCAAATTAGG No data
1023699293_1023699298 13 Left 1023699293 7:42876556-42876578 CCCCGGATCACACAGATCGTGGC No data
Right 1023699298 7:42876592-42876614 AAATTAGGGCCTGACTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023699293 Original CRISPR GCCACGATCTGTGTGATCCG GGG (reversed) Intergenic
No off target data available for this crispr