ID: 1023699772

View in Genome Browser
Species Human (GRCh38)
Location 7:42881693-42881715
Sequence CAAGATGAACTCAGCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023699772_1023699777 18 Left 1023699772 7:42881693-42881715 CCAATATGGCTGAGTTCATCTTG No data
Right 1023699777 7:42881734-42881756 GGCTGTCTTCATTCATTCACGGG No data
1023699772_1023699774 -3 Left 1023699772 7:42881693-42881715 CCAATATGGCTGAGTTCATCTTG No data
Right 1023699774 7:42881713-42881735 TTGCTTCTAGCCTCACAGGCTGG 0: 46
1: 91
2: 97
3: 55
4: 151
1023699772_1023699773 -7 Left 1023699772 7:42881693-42881715 CCAATATGGCTGAGTTCATCTTG No data
Right 1023699773 7:42881709-42881731 CATCTTGCTTCTAGCCTCACAGG 0: 50
1: 113
2: 94
3: 85
4: 199
1023699772_1023699776 17 Left 1023699772 7:42881693-42881715 CCAATATGGCTGAGTTCATCTTG No data
Right 1023699776 7:42881733-42881755 TGGCTGTCTTCATTCATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023699772 Original CRISPR CAAGATGAACTCAGCCATAT TGG (reversed) Intergenic
No off target data available for this crispr