ID: 1023700770

View in Genome Browser
Species Human (GRCh38)
Location 7:42889998-42890020
Sequence TTGCATATTCATTTGTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023700768_1023700770 30 Left 1023700768 7:42889945-42889967 CCATGTAATCTTGAGCAGGTAAC No data
Right 1023700770 7:42889998-42890020 TTGCATATTCATTTGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023700770 Original CRISPR TTGCATATTCATTTGTAGCA TGG Intergenic
No off target data available for this crispr