ID: 1023703139

View in Genome Browser
Species Human (GRCh38)
Location 7:42912046-42912068
Sequence GATGCAGGAGGTGCCCGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023703139_1023703151 23 Left 1023703139 7:42912046-42912068 CCGCCTCGGGCACCTCCTGCATC 0: 1
1: 0
2: 3
3: 32
4: 312
Right 1023703151 7:42912092-42912114 CCAAACCTGCGATTCCCAAGCGG 0: 2
1: 0
2: 1
3: 9
4: 85
1023703139_1023703144 -10 Left 1023703139 7:42912046-42912068 CCGCCTCGGGCACCTCCTGCATC 0: 1
1: 0
2: 3
3: 32
4: 312
Right 1023703144 7:42912059-42912081 CTCCTGCATCACGTGGTTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 140
1023703139_1023703147 -5 Left 1023703139 7:42912046-42912068 CCGCCTCGGGCACCTCCTGCATC 0: 1
1: 0
2: 3
3: 32
4: 312
Right 1023703147 7:42912064-42912086 GCATCACGTGGTTCCGGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1023703139_1023703146 -6 Left 1023703139 7:42912046-42912068 CCGCCTCGGGCACCTCCTGCATC 0: 1
1: 0
2: 3
3: 32
4: 312
Right 1023703146 7:42912063-42912085 TGCATCACGTGGTTCCGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023703139 Original CRISPR GATGCAGGAGGTGCCCGAGG CGG (reversed) Exonic
900105193 1:978126-978148 GAGGCAGGCGGTTCCCGGGGCGG - Intronic
900420927 1:2555613-2555635 GCAGCAGGCGGTGCCAGAGGGGG + Intergenic
900671575 1:3857804-3857826 GGTGCAGGCGGCGCCCGGGGCGG + Intronic
900985677 1:6071789-6071811 GCGGCAGGAGGTGCCCTATGTGG - Intronic
900985687 1:6071826-6071848 GCGGCAGGAGGTGCCCTATGCGG - Intronic
901445889 1:9307932-9307954 GATGCCAGAGGTGCCCCATGGGG + Intronic
903010576 1:20327413-20327435 GATGCAGAAGGTCCCACAGGAGG + Intronic
903029124 1:20450263-20450285 GGTGCAGGAGGGGCAGGAGGGGG + Intergenic
903514476 1:23901457-23901479 TATGCCTGAGGTGCCCGGGGAGG - Intronic
903558794 1:24212400-24212422 GATGGAGGTGGTGACGGAGGTGG + Intergenic
903672322 1:25043811-25043833 GATGCAGGAGGAGTCGGAGCTGG - Intergenic
904688305 1:32275777-32275799 GACGCGGGATGAGCCCGAGGTGG + Intronic
905294725 1:36947033-36947055 GTAGCAGGAGGTGCTAGAGGAGG + Intronic
907389779 1:54150726-54150748 GAGGCAGGAGGTAGCCGAGCTGG - Intronic
907431476 1:54414567-54414589 GATGCAGGAGGAGCCAGTGAAGG + Intergenic
907682782 1:56579481-56579503 GGAGCAGGAGGAGCCGGAGGAGG - Exonic
910934974 1:92480295-92480317 GATGCAGAAGATCCCCGAGCAGG + Intronic
913486465 1:119336231-119336253 GATGCAGGTGGTAGCCAAGGTGG - Intergenic
918634877 1:186763947-186763969 GAGGCAGGAGGTGGCTGAGTGGG - Intergenic
920955963 1:210620307-210620329 GAGCCAGGAGGTTCCCAAGGTGG + Intronic
922314602 1:224432798-224432820 GATGAAGGAGGTGCAAGAGACGG - Intronic
922428047 1:225517909-225517931 GATGGAGGAGGTGCTGAAGGAGG + Intronic
922740248 1:228010438-228010460 GAAGCAGGAGGTGGCCGTGGCGG - Intronic
1064110961 10:12538624-12538646 GTTCCAGGAAGGGCCCGAGGAGG + Intronic
1066442792 10:35454663-35454685 CCTGCATGAGGTGCCCGGGGAGG + Intronic
1067406661 10:46030180-46030202 GGAGCAGGAGGTGTCCGAGCCGG + Intronic
1067554303 10:47257469-47257491 GATGGTGGAGATGCCAGAGGAGG + Intergenic
1070376383 10:75835347-75835369 GATGCAGGAGGAGTCAGAGTCGG - Intronic
1070778969 10:79126612-79126634 GAGGCTGGAGGTGCCCCCGGGGG + Intronic
1071673699 10:87635753-87635775 GAGGCAGGAGGAGCCCAAAGTGG + Intergenic
1075556349 10:123435322-123435344 GATGCAGCAGCTGCCCCAGCAGG + Intergenic
1075735698 10:124663463-124663485 GCTGCAAGAGGAGCCAGAGGAGG + Intronic
1076821753 10:132943151-132943173 GCAGCAGGGGGTGGCCGAGGCGG + Intergenic
1077573354 11:3357402-3357424 GATGGAGGAGGCACCCGAAGCGG + Intronic
1080668539 11:34356805-34356827 GATGGCGGAGGGGCCGGAGGCGG - Exonic
1080779799 11:35419565-35419587 GTTAAAGGAGTTGCCCGAGGCGG - Intronic
1081492715 11:43580152-43580174 GATGGAGGAGGGGGCCGAGCGGG + Intronic
1081528575 11:43943090-43943112 GATCCAGGAGGTGGAGGAGGAGG + Exonic
1082635090 11:55584918-55584940 GAGGCAGGAGGTACTGGAGGAGG - Intergenic
1082662696 11:55932341-55932363 AATTCAGGAGGTGCACGTGGAGG - Intergenic
1083681083 11:64352174-64352196 GAAGCTGGAGGTGCTGGAGGAGG + Exonic
1083920636 11:65780136-65780158 CCGGCAGGAGGCGCCCGAGGTGG + Exonic
1084475109 11:69384522-69384544 GATGCCAAAGGTGCCCTAGGTGG - Intergenic
1085410532 11:76287991-76288013 GGAGCAGGAGGTACCAGAGGGGG - Intergenic
1089022326 11:115229197-115229219 GATGCTGAAGGTGCACAAGGAGG - Exonic
1089729887 11:120512867-120512889 GGTGGAGGAGGCGGCCGAGGGGG + Intronic
1090532831 11:127608939-127608961 GGTGAAGGTGGTGGCCGAGGAGG - Intergenic
1091282395 11:134389599-134389621 GATGCAGCAGGGACCCGTGGGGG + Exonic
1091350829 11:134892686-134892708 GATTTGGGAGGTGCCAGAGGTGG + Intergenic
1091389487 12:117448-117470 GAGGGAGGCGGTGCCTGAGGAGG + Intronic
1091750089 12:3016943-3016965 GAGGCAGGAGGGGCCACAGGAGG + Intronic
1092149302 12:6236128-6236150 GAGGGAGGAGGTGCCCTGGGAGG + Intronic
1093795393 12:23304148-23304170 GTTGGAGGAGCTGCCTGAGGAGG - Intergenic
1097196536 12:57245175-57245197 GATGGAGGAGGAGCCAGAGTCGG - Exonic
1103339646 12:120214738-120214760 GATGCAGGGGGTGCCGTGGGAGG - Intronic
1104895434 12:132161493-132161515 GAAGGAGGAGGTGACGGAGGAGG - Intergenic
1106503835 13:30354736-30354758 GAGGCAAGAGGTGCCATAGGAGG - Intergenic
1107007980 13:35636629-35636651 GATTCAGGAGGTGAAGGAGGAGG - Intronic
1108993396 13:56693801-56693823 GAAGCAGGAGGTGCAAGTGGGGG + Intergenic
1112146977 13:96710711-96710733 GGGGCAGGAGGTGGCCTAGGAGG - Intronic
1112431058 13:99350554-99350576 GGTGCAGGGGGTGCCAGAGAGGG + Intronic
1113812093 13:113149184-113149206 GATGCTGGAGGTGCCCTACGTGG + Exonic
1118613251 14:67557663-67557685 GAGGCAGCAGGTGCTAGAGGTGG - Intronic
1119777757 14:77259073-77259095 GAGGCAGGAGGTGCCTGAGAGGG - Exonic
1120724616 14:87923825-87923847 GATGGAGGAGGTGACAGAGGAGG + Intronic
1122658682 14:103279661-103279683 CATGCAGGCGGTGCGCGAGACGG + Intergenic
1122993646 14:105250664-105250686 TATGCCTGAGGTGCCCGGGGAGG + Exonic
1128319157 15:66680644-66680666 GCTGCAGGAGGTGGCCTAGCTGG + Intronic
1128383059 15:67127398-67127420 CCTGGAGGAGGTGCCTGAGGAGG - Intronic
1128474918 15:67989068-67989090 GAAAAAGGAGATGCCCGAGGTGG - Intergenic
1128608162 15:69053824-69053846 GAAGCAGGGGGTCCCCCAGGTGG + Intronic
1129513658 15:76143154-76143176 GATGAAGCAGGTGCCTGAGAAGG - Intronic
1129910118 15:79220055-79220077 GATGCAGGAGGAGAGAGAGGAGG + Intergenic
1131998432 15:98155934-98155956 GATGTCAGAGGTGCACGAGGTGG - Intergenic
1132479563 16:160344-160366 GCTGCAAGAGGTGCCCGGGACGG + Intronic
1132657954 16:1049128-1049150 GGTGCAGCAGGCGGCCGAGGAGG - Intergenic
1132737779 16:1395603-1395625 GAGGCAGGAGGTTCCTGGGGCGG - Intronic
1134768648 16:16784750-16784772 GATGCAGGAGGTGCCATCAGTGG + Intergenic
1135250893 16:20900393-20900415 GATGCAGGAGGCGATGGAGGGGG - Intronic
1135814774 16:25622562-25622584 GATGCAGGTGGAGGCAGAGGTGG - Intergenic
1136296554 16:29307329-29307351 GGTGCAGGAGGTGCCAGGAGTGG + Intergenic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1137580390 16:49630302-49630324 GATGCTGGAGACACCCGAGGTGG - Intronic
1138416451 16:56874314-56874336 GGTGCAGGAGGCGCCAGAGCTGG + Intronic
1139961902 16:70722704-70722726 GATGCAGGCAGGGCCCAAGGAGG + Intronic
1141733757 16:85839220-85839242 GATGGAGGAGGTCCCAGAAGAGG + Intergenic
1141766776 16:86064199-86064221 GATGGAGGAGGAGCCAGTGGTGG - Intergenic
1142409339 16:89908132-89908154 GAGGCAGGAGGTGGCAGGGGAGG - Intronic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1143139574 17:4733736-4733758 GATGCAGGAGAGGGCTGAGGTGG + Exonic
1143154446 17:4827324-4827346 GATGCAGGAGGAAACTGAGGGGG + Intergenic
1143247764 17:5500627-5500649 GATGCAGGAGGTGATGGAGAAGG + Intronic
1143735035 17:8905627-8905649 GATGCTGGAGGTGAGGGAGGAGG - Intronic
1144218583 17:13079684-13079706 GAGGCAGAAGATGCCTGAGGTGG - Intergenic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146842642 17:36166407-36166429 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146854954 17:36254366-36254388 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146865666 17:36334010-36334032 GAAGAACGAGGTGCCCGTGGCGG - Exonic
1146870854 17:36378258-36378280 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146878213 17:36429340-36429362 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146882162 17:36450486-36450508 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147068535 17:37934622-37934644 GAAGAACGAGGTGCCCGTGGCGG - Exonic
1147073738 17:37978882-37978904 GAAGAACGAGGTGCCCGTGGCGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147080058 17:38014159-38014181 GAAGAACGAGGTGCCCGTGGCGG - Intronic
1147085259 17:38058420-38058442 GAAGAACGAGGTGCCCGTGGCGG + Exonic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147096007 17:38138119-38138141 GAAGAACGAGGTGCCCGTGGCGG - Intergenic
1147101206 17:38182386-38182408 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147678661 17:42224945-42224967 GATTCAGGAGGTCCCTCAGGAGG - Intronic
1147840638 17:43369053-43369075 GGTCCAGGAGGTGACCCAGGAGG + Intergenic
1148052950 17:44778069-44778091 GAGGCTGGAGCTGGCCGAGGGGG + Intronic
1149549679 17:57531085-57531107 GATGAAGGTGGTGCCCGTGGTGG + Intronic
1149756837 17:59193660-59193682 GGTGGAGGAGGTGGCAGAGGTGG - Exonic
1149845804 17:60008892-60008914 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150084152 17:62265472-62265494 GAAGAACGAGGTGCCCGTGGCGG + Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150425077 17:65070698-65070720 GATGCACGAGGTGCCAGAGCTGG - Intergenic
1151811763 17:76447778-76447800 GAAGCAAAAGGTGCACGAGGCGG - Intronic
1152569738 17:81116434-81116456 GAGGCAGGAGGGGCCTGGGGAGG - Exonic
1152610600 17:81313442-81313464 GTTTCAGGAGGTGGCCGGGGTGG + Exonic
1152793365 17:82293533-82293555 GATCCAGGCGGTGCCCCGGGCGG - Intergenic
1152820630 17:82435991-82436013 GATGCAGGAGGTGGTTGTGGCGG - Intronic
1154317524 18:13316784-13316806 GATGCATGTGGTGACAGAGGAGG + Intronic
1155392251 18:25350022-25350044 GGTGGAGGAGGCGGCCGAGGAGG + Intronic
1155657855 18:28211711-28211733 GAGGCAGGAGGTACAGGAGGAGG + Intergenic
1156291824 18:35754534-35754556 GATGAAGGAGCTGGCTGAGGTGG + Intergenic
1158757130 18:60339120-60339142 GAAGCAGAAGGTCCCCCAGGAGG - Intergenic
1160439072 18:78875275-78875297 GCTGCAGGAGGTGTGGGAGGTGG + Intergenic
1160890834 19:1377944-1377966 GACTCGGGAGGTGCCAGAGGCGG + Exonic
1160904470 19:1445942-1445964 GAGGCTGGGGGGGCCCGAGGCGG - Intergenic
1160912505 19:1481463-1481485 GTTGGACGCGGTGCCCGAGGCGG + Exonic
1161558592 19:4958124-4958146 GAGGCAGGTGGGGCCCGAGGAGG - Intronic
1161595726 19:5150188-5150210 GCTGCAGGCGGTGTCAGAGGTGG + Intronic
1162332444 19:10038602-10038624 CATGAATGAGGAGCCCGAGGTGG - Intergenic
1163155960 19:15440093-15440115 GCTGGAGGAGGTGGCCGAAGGGG - Intronic
1163160276 19:15460134-15460156 TATGCAGGAGGTGGAGGAGGAGG + Intronic
1163469440 19:17487919-17487941 GGAGCAGGAGGAGCCCGAGGAGG - Intronic
1163471073 19:17497293-17497315 GAAGCAGCCGGTGCGCGAGGCGG + Exonic
1163654829 19:18539583-18539605 GGTGCAGGAGGAGCCGGAGCTGG - Exonic
1163686243 19:18713561-18713583 GAGGGAGGAGGGGCACGAGGAGG - Intronic
1163713412 19:18860411-18860433 CAGGTAGGAGGTGCCCGAGCTGG - Exonic
1164635896 19:29791359-29791381 GATCCAGGAGGTGGCCGAGGGGG - Intergenic
1164767336 19:30781941-30781963 GGTGCAGGAGGTGCCCTGGGTGG + Intergenic
1165406416 19:35633807-35633829 GGGGCAGGAGGTGCCCCAGCTGG + Exonic
1166095196 19:40534094-40534116 GATGCAGGAGAAGCCCGAACTGG + Exonic
1167426126 19:49430592-49430614 GGTGCAGGGGGTGCCCCCGGGGG + Exonic
1167828754 19:52000357-52000379 GATTCAGGAGGTGCATCAGGAGG - Exonic
925741346 2:7008277-7008299 GAAGCTGGACGTTCCCGAGGAGG - Intronic
926504877 2:13701295-13701317 GAGGGATGAGGTGCCGGAGGAGG + Intergenic
927869499 2:26614606-26614628 GATGGAGGGGTTGCCTGAGGTGG - Intronic
928927876 2:36597550-36597572 GCCCCAGGAGGTGCCCCAGGAGG + Intronic
929158830 2:38811595-38811617 GATGCAGGAGGTGTCCAGGCCGG + Intronic
929532876 2:42763466-42763488 GAGGCAGGAGGGGCCGGAGAAGG + Exonic
934295238 2:91737646-91737668 GATGCAGGAGCTGCCAGTGTGGG + Intergenic
935718755 2:105961069-105961091 GACGCAGGAGATGCACCAGGAGG - Intergenic
936354714 2:111740117-111740139 GATGCATGAGGTCACCAAGGAGG + Intergenic
937059883 2:118973489-118973511 GAGGCAGGTGGTGTCCGAGGAGG - Intronic
937449777 2:121992606-121992628 GATGCTGGAGGTGCTGGAGGAGG + Intergenic
938685825 2:133736807-133736829 GATGCAGGAGGAGAAAGAGGAGG + Intergenic
942948372 2:181694856-181694878 GAAGGAGGTGGTGCCCGATGCGG - Intergenic
942991635 2:182209059-182209081 GATTCAGGAGGGGCCAGAAGTGG + Intronic
943788274 2:191902187-191902209 GATCTGGGAGGTGCCAGAGGTGG + Intergenic
947595952 2:231412093-231412115 GGGGCAGGCGGAGCCCGAGGGGG - Intergenic
947605426 2:231482882-231482904 GACGCGGCAGGGGCCCGAGGTGG + Intronic
948080514 2:235201994-235202016 GATGCAGGAGGAGGCCGAGGAGG - Intergenic
948389812 2:237603959-237603981 GATGCAGGAGGTGTGGGTGGGGG + Intergenic
1168757128 20:325612-325634 GCTGCAGGAAGAGCCCGCGGGGG + Exonic
1170053800 20:12176529-12176551 GATGCAGGTGGGGCCCAAGGTGG + Intergenic
1171436354 20:25127591-25127613 GAGGCATGAGGAGCCCCAGGTGG - Intergenic
1172061440 20:32189876-32189898 GAAGCAGGAGGTGGCAGCGGAGG - Intergenic
1172178819 20:32988321-32988343 GATCCTGGGGGTGCCCGAGTTGG + Intronic
1173378011 20:42507301-42507323 GATGAAGCAGATGCCAGAGGAGG + Intronic
1173756474 20:45521106-45521128 GAGGCAGGAGGAGCCCAAAGTGG + Intergenic
1173946998 20:46959568-46959590 GATGCAGGAGGAAGCTGAGGAGG - Intronic
1174158982 20:48536931-48536953 GATGCTGGAGGTGGCAGAAGTGG + Intergenic
1174262883 20:49309888-49309910 GAGGAAGGAGGTGGCTGAGGAGG - Intergenic
1174399176 20:50266859-50266881 TAAGCAGGAGATGCCCGAGGCGG + Intergenic
1175258676 20:57661895-57661917 GATGCATAAAGTGCCCGAGACGG - Intronic
1175949658 20:62576556-62576578 GAGGCAGGGGGTGCCGGAGGAGG + Intergenic
1176141724 20:63547805-63547827 GCTCCAGGAGGGGCCCGAGGAGG + Intergenic
1176287967 21:5028795-5028817 GAGGCAGGAGATGATCGAGGAGG + Intronic
1179644746 21:42768601-42768623 GAAGCAGGAGGGGGCCCAGGAGG + Intronic
1179869214 21:44234680-44234702 GAGGCAGGAGATGATCGAGGAGG - Intronic
1181506345 22:23360788-23360810 GGTGCCGGAGGTGTCCAAGGTGG + Intergenic
1181567830 22:23750722-23750744 GATGCAGGAGGACCCGGAGAAGG - Exonic
1181609370 22:24002240-24002262 GATGGAGGGTGAGCCCGAGGGGG + Intergenic
1182092535 22:27605628-27605650 GATGCAGGAGAGGCTAGAGGTGG - Intergenic
1182729403 22:32475038-32475060 GCCGCTGGAGGTGCCCGAGACGG + Exonic
1182914034 22:34011267-34011289 GAGGCAGGAGGTGCTAGTGGAGG - Intergenic
1183301543 22:37061376-37061398 GAGGCAGGAGGTACCAGAAGGGG - Intronic
1183492620 22:38124734-38124756 GATGCAGGAGGTGCCCAAGAGGG + Intronic
1184022221 22:41828444-41828466 GAGGAAGGAGGTGCCAGAAGGGG - Intergenic
1184228985 22:43148107-43148129 CATGCAGGAGGGGGCGGAGGTGG + Intergenic
1184256200 22:43288486-43288508 GAAGCGGGAGGAGCCCGAGGCGG - Intronic
1185071911 22:48661280-48661302 CAGGCAAGACGTGCCCGAGGCGG - Intronic
949947544 3:9202458-9202480 TGTGCAGGAGCTGCCCCAGGAGG - Intronic
949973650 3:9434298-9434320 GAAGCAGGAGGTGTCGGAGGAGG - Intronic
950575948 3:13832136-13832158 GGAGCAGGAGGAGCCTGAGGAGG - Intronic
959818425 3:110703587-110703609 GATTCAGGAGGGGCCAGGGGTGG - Intergenic
960993183 3:123324914-123324936 AATGCAGGAGGTGCTGGAAGAGG + Intronic
961403324 3:126662423-126662445 GATGCAGGAGGAGCAGGTGGGGG + Intergenic
962408131 3:135117743-135117765 CTTGCAGGAGATGCCCAAGGTGG + Intronic
966869941 3:184283862-184283884 GATGCAGCAGGTGCTGGAGTTGG + Exonic
968669908 4:1843686-1843708 GATTGGGGAGGTGACCGAGGTGG - Intronic
968689569 4:1983730-1983752 GATGCAGGAGGTGGTCCTGGCGG - Intronic
968813315 4:2809642-2809664 GAGGCAGGAGGTGCCAGGGCAGG + Intronic
969043880 4:4322594-4322616 GATGAGGGAGGAGCCAGAGGAGG - Intergenic
969610612 4:8225814-8225836 CAGGCAGGAGGTCCCAGAGGAGG + Intronic
971382042 4:26107933-26107955 GATGAAGCAGGAGCCCAAGGAGG - Intergenic
977143637 4:93407837-93407859 GAAGCAGGAGGTGGAGGAGGAGG - Intronic
981979173 4:150771023-150771045 GAGGCAGGAGGAGCCCAAAGTGG + Intronic
982199128 4:152943145-152943167 GGTGGAGGAGGTGCTGGAGGAGG - Exonic
982790493 4:159586274-159586296 GATTTGGGAGGTGCCAGAGGTGG - Intergenic
985725751 5:1515064-1515086 GATGCAGGATGTGCTGGGGGTGG - Intronic
987039302 5:14046774-14046796 GATGCAGGAGGAGTCAGAGTGGG - Intergenic
990470657 5:56112212-56112234 GATGGAGGAGGTTGCTGAGGTGG + Intronic
992233517 5:74685514-74685536 GGTGCAGGAGGGGCCCGCCGTGG - Exonic
993606143 5:89992779-89992801 GATGCTGGAGGTGTCAGTGGTGG - Intergenic
996091857 5:119359151-119359173 GGTGTAGGAGGAGCCCAAGGTGG - Intronic
997232268 5:132253695-132253717 GATGCTGGAGGCTCCAGAGGGGG - Intronic
997395542 5:133557046-133557068 GCTGCAGGAGGTACCTGGGGAGG - Intronic
999233031 5:150073434-150073456 CATCCAGGAGGTGACCGTGGGGG - Exonic
999690316 5:154140768-154140790 GCTGCAGGAGGGGCCAGAGAAGG - Intronic
1000460693 5:161513755-161513777 GATTCAGGAGGTGCACGTGCAGG - Intronic
1001128909 5:169047209-169047231 GTTGCAGGAGGATCCAGAGGAGG - Intronic
1002376522 5:178793141-178793163 GATGTGGGAGGTGCCAGAAGCGG - Intergenic
1002534418 5:179868426-179868448 GATGCAGTAGGAGGCCCAGGCGG - Intronic
1003072658 6:2957228-2957250 GATGCAGGAGTTCCCGGGGGAGG - Intronic
1005566177 6:27097018-27097040 GAGGCAGGAGGCGCCTGAGCAGG - Intergenic
1006634577 6:35452641-35452663 GCTGCAGGCGGGGCCTGAGGGGG + Exonic
1007178619 6:39912909-39912931 GCTGGAGAAGGTGCCAGAGGAGG - Exonic
1007339241 6:41179797-41179819 AATGCTGAAGGTGCCAGAGGAGG - Intergenic
1007987004 6:46217044-46217066 GATGCAGGCTGTCCCTGAGGAGG + Intergenic
1008007850 6:46431026-46431048 GAAGCAGGAGGTGCTCTTGGAGG + Intronic
1014136330 6:117894235-117894257 GATGGTGGAGGTGACGGAGGTGG + Intergenic
1015540542 6:134309362-134309384 GGTGAAGGAGGTGCAGGAGGAGG - Intronic
1015616189 6:135077998-135078020 GATGCTGGAGGTGCCAGGTGCGG + Intronic
1015786552 6:136924444-136924466 GATGGAGGAGCTGCCCGGGGAGG + Exonic
1018676739 6:166228950-166228972 GATGCAGGAAGGACACGAGGTGG + Intergenic
1019292612 7:257929-257951 GGTGCTGGAGATGCCCGGGGTGG + Intronic
1019527506 7:1487364-1487386 GGCACAAGAGGTGCCCGAGGCGG + Exonic
1019575015 7:1733421-1733443 GAGGCAGGAGGAGCCCTGGGCGG + Intronic
1019604535 7:1901875-1901897 TGTGGAGGAGGGGCCCGAGGAGG - Intronic
1020105377 7:5420238-5420260 GCTGGAGGAGGTGGCCGAGAAGG - Intronic
1020279363 7:6642613-6642635 GGTGGAGGCGGTGGCCGAGGTGG + Exonic
1020484216 7:8701412-8701434 GATGCAAGAGGTGCAAGAGGAGG - Intronic
1021918109 7:25455699-25455721 GATGCAGAAGGGGGCAGAGGTGG - Intergenic
1022121696 7:27314620-27314642 GCTGCAGGAGGGGACCCAGGCGG + Intergenic
1022419839 7:30210099-30210121 CTTGCAGGAGCTGCCGGAGGAGG + Intergenic
1023013574 7:35944026-35944048 GCTGCAGAAGGGGCCTGAGGAGG + Intergenic
1023638618 7:42237247-42237269 GATGCCGGAGCTGCACGAGCGGG - Intronic
1023703139 7:42912046-42912068 GATGCAGGAGGTGCCCGAGGCGG - Exonic
1023818287 7:43966323-43966345 GCTGCAGGAGGGGGCCGTGGAGG - Intergenic
1023876433 7:44288809-44288831 AATGAAGGAGGTGCCCGAGCAGG - Intronic
1024077554 7:45829808-45829830 GCTGCAGAAGGGGCCTGAGGAGG - Intergenic
1025126856 7:56351604-56351626 GCTGCAGAAGGGGCCTGAGGAGG + Intergenic
1027189859 7:75990247-75990269 GTTGCAGGTGGGGCCCGAGGTGG - Intronic
1027852734 7:83469614-83469636 ACTGCAGGAGGTGCCTGAGTTGG - Intronic
1029195369 7:98801986-98802008 GATGCAGGAGGAGCCCTGGATGG - Intergenic
1029440033 7:100582421-100582443 GTTTCCCGAGGTGCCCGAGGCGG - Exonic
1029466488 7:100728547-100728569 GCTGCAGGAGGTGGCTGAGTTGG - Intergenic
1030001071 7:105063372-105063394 GAAGCCGGAGGTGTCGGAGGAGG - Exonic
1030506915 7:110436324-110436346 GAGGTAGGAGGAGCCCGAAGTGG - Intergenic
1031626741 7:124000909-124000931 GATTCGGGAGGGGCCAGAGGTGG - Intergenic
1032491309 7:132326544-132326566 GATGCAGGGGCTGGCAGAGGAGG - Intronic
1032779536 7:135152893-135152915 GCTGCTGGTGGTGCCCGATGGGG + Intronic
1034496782 7:151427846-151427868 GATGCAGGAGGAGGAAGAGGAGG - Intergenic
1034829255 7:154294966-154294988 GTGGCAGGAGGTGACCGAGGAGG + Intronic
1034970708 7:155417708-155417730 GATCCAGGAGGAGCAGGAGGAGG - Intergenic
1035326640 7:158070363-158070385 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326656 7:158070432-158070454 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326662 7:158070450-158070472 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326673 7:158070486-158070508 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326696 7:158070561-158070583 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326729 7:158070666-158070688 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326752 7:158070737-158070759 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326761 7:158070770-158070792 CATGGTGGAGGTGCCCGTGGTGG + Intronic
1035326767 7:158070788-158070810 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326811 7:158070934-158070956 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326843 7:158071071-158071093 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326853 7:158071107-158071129 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326876 7:158071211-158071233 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035326890 7:158071264-158071286 GGTGGTGGAGGTGCCCGTGGTGG + Intronic
1035675584 8:1453273-1453295 GAAGCAGGAGGAGCCTGGGGAGG + Intergenic
1039475583 8:37837819-37837841 GAGCCAGGAGGGGCCCGGGGAGG + Exonic
1039527031 8:38226121-38226143 GATGCATGAGGAGCCCAAAGTGG + Intronic
1039907038 8:41794266-41794288 GAGGCAGGAGGAGCAGGAGGAGG - Intronic
1041254197 8:55965336-55965358 GATGCAGCAGGTGCCCTGGGAGG - Intronic
1043599808 8:81923588-81923610 GATGCATGAGGAGCCCCAAGGGG - Intergenic
1044220317 8:89662734-89662756 GATGTGGGAGGGGCCAGAGGTGG - Intergenic
1046808209 8:118503703-118503725 GATGGAGGAAGAGCCCAAGGAGG - Intronic
1047654974 8:126967454-126967476 GATGGAGGAGGAGCAGGAGGAGG + Intergenic
1048781622 8:138007906-138007928 GATTTGGGAGGTGCCTGAGGTGG + Intergenic
1049028252 8:140012619-140012641 GATGCAGGAGGGCCGAGAGGTGG - Intronic
1049095680 8:140546894-140546916 CAGTCAGGAGGTGCCAGAGGAGG + Intronic
1049597765 8:143492577-143492599 GATGCCGGAGGGGCCCGGGGAGG + Intronic
1049668296 8:143858610-143858632 GCTGCAGGAGGTGACGGAGATGG - Exonic
1049668712 8:143860209-143860231 GCTGCAGGAGGTGACGGAGATGG - Exonic
1049669127 8:143861811-143861833 GCTGCAGGAGGTGACGGAGATGG - Exonic
1049669542 8:143863413-143863435 GCTGCAGGAGGTGACGGAGATGG - Exonic
1049669952 8:143865006-143865028 GCTGCAGGAGGTGACGGAGATGG - Exonic
1049681960 8:143923091-143923113 GATGAAGCAGGTGGCGGAGGAGG - Exonic
1053070908 9:35101410-35101432 GATGCAGGTGGGGGCCAAGGAGG - Exonic
1055302485 9:74896847-74896869 GCTGCAGGGGCTGCCTGAGGAGG - Intergenic
1058461923 9:105190865-105190887 GGGGCAGGAGGTGGCCAAGGTGG - Intergenic
1059597481 9:115737811-115737833 GATGCTGCAGCTGCCCTAGGAGG - Intergenic
1060069834 9:120536409-120536431 GATGAAGAAGATGCACGAGGGGG - Exonic
1060197407 9:121632577-121632599 TATGCTGGAGGGGCCAGAGGAGG - Intronic
1060588525 9:124801635-124801657 CAAGCAGGAGGTGACCGAGGCGG + Exonic
1061822363 9:133235631-133235653 GAGGCAGGAGATGTCTGAGGTGG + Intergenic
1061893979 9:133637395-133637417 GCTGCAGGGGGTCCCCGAAGTGG + Intronic
1062112371 9:134789070-134789092 CATGCAGGTGGTCCCCCAGGCGG + Intronic
1062213783 9:135378235-135378257 GCTGTAGGAGGTGCCCAGGGGGG + Intergenic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1062673588 9:137725942-137725964 GATTCAGGAGGTGCTTGTGGAGG - Intronic
1193724702 X:85025374-85025396 GATTTAGGAGGCGCCAGAGGTGG - Intronic
1196905768 X:120432605-120432627 GATGTAGGGGGTGTACGAGGAGG + Intronic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1199879346 X:151960820-151960842 GATGCAGGAGGTGAGGGAGAGGG + Intronic
1200000544 X:153057631-153057653 GATGTGGCAGGTGCCCGAGGGGG + Exonic
1200486392 Y:3773661-3773683 GATGCATGAGGAGCCCAAAGTGG + Intergenic
1200829774 Y:7679054-7679076 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1200886951 Y:8280239-8280261 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1200988260 Y:9325953-9325975 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1201017973 Y:9624389-9624411 GATGGAGGTGGTGACCAAGGAGG + Intergenic
1202119761 Y:21510241-21510263 GATGGAGGTGGTGGCCAAGGAGG - Intergenic
1202122214 Y:21533782-21533804 GATGGAGGTGGTGGCCAAGGAGG - Intronic
1202156793 Y:21895601-21895623 GATGGAGGTGGTGGCCAAGGAGG + Intronic
1202159239 Y:21919142-21919164 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1202185688 Y:22184057-22184079 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1202197159 Y:22307723-22307745 GATGGAGGTGGTGGCCAAGGAGG - Intergenic
1202205672 Y:22402339-22402361 GATGGAGGTGGTGGCCAAGGAGG - Intronic