ID: 1023705740

View in Genome Browser
Species Human (GRCh38)
Location 7:42940137-42940159
Sequence TTCTGTTTTCAATTCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 437}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023705739_1023705740 9 Left 1023705739 7:42940105-42940127 CCTAGTGAGAGTACGTGGGCAGA 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1023705740 7:42940137-42940159 TTCTGTTTTCAATTCATGAATGG 0: 1
1: 0
2: 1
3: 33
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023705740 Original CRISPR TTCTGTTTTCAATTCATGAA TGG Intronic
906835227 1:49076042-49076064 TTCTGCTTTCAATTTAAGTAAGG + Intronic
907004389 1:50895842-50895864 TTTTTTTTTAAAATCATGAAGGG - Intronic
907582009 1:55580802-55580824 TACAGTTTCCAATTCGTGAATGG + Intergenic
907843910 1:58186068-58186090 TTCTGTTTAGAAGTCTTGAATGG - Intronic
908554572 1:65245003-65245025 TTCTGTGTTCAATTCAAGGAAGG + Intergenic
908798431 1:67854150-67854172 TATGGTTTTCATTTCATGAATGG + Intergenic
909293834 1:73918864-73918886 TACTTTTTTCATTTCATGTAAGG - Intergenic
910084944 1:83389532-83389554 TTCCATTTTCAGTTCATGGAAGG + Intergenic
910152432 1:84166990-84167012 TTCTGTTTTCACTTCCTGTATGG - Intronic
910677418 1:89828515-89828537 TTGTTTTTTCATTTTATGAAAGG + Intronic
910825352 1:91401281-91401303 CTCTGTTTTCCATTCATTCATGG + Intronic
911077229 1:93888449-93888471 TTCACTCTTCAATACATGAATGG - Exonic
911181665 1:94866291-94866313 TTCTCTTTTAGATTTATGAAAGG - Intronic
912662681 1:111547283-111547305 GTGTGTTTTTAAATCATGAAAGG + Intronic
913125779 1:115787657-115787679 TTCTTTTTTTTAGTCATGAATGG - Intergenic
915859934 1:159433267-159433289 TTCTTTTTTCAATCTATGAGGGG - Intergenic
916679514 1:167091116-167091138 TTCATTTTTCATTTAATGAAAGG + Intergenic
916701110 1:167295925-167295947 TGCTGTTTTTAATTCAGAAAGGG + Intronic
917170716 1:172170633-172170655 ATCTGTTTAGAATTTATGAATGG + Intronic
918053282 1:180993989-180994011 TTCTGAGTTGGATTCATGAAAGG + Intronic
918269021 1:182877889-182877911 TTGTGATGTCTATTCATGAATGG - Intronic
918623236 1:186629238-186629260 TTCTATTTTTAAATCATGAGTGG + Intergenic
918849012 1:189659233-189659255 CTCTATTTTCTATTGATGAAGGG + Intergenic
919260579 1:195188827-195188849 TTCTGGTTTCAATGAATAAAAGG + Intergenic
919479579 1:198071596-198071618 TTTTTTTTTCTATTCCTGAATGG + Intergenic
919572412 1:199265401-199265423 TCCTGGTCTCAAATCATGAATGG + Intergenic
920922286 1:210308169-210308191 TTCTATTTTAAATTCATTTAAGG + Intergenic
920943537 1:210506487-210506509 TTCTGTTTTTAATTTCTGGAAGG + Intronic
921379651 1:214511616-214511638 TTCTGTTTTTAATTTGTTAAAGG - Intronic
921558736 1:216630845-216630867 TTCTCTTTTCATTTTCTGAAAGG - Intronic
922151457 1:223008363-223008385 TTTTATTTTCAATTCATTACTGG + Intergenic
922736891 1:227990329-227990351 TTTTTTTTTTAAATCATGAAAGG - Intergenic
923375313 1:233356104-233356126 TTCTGTGCCCATTTCATGAATGG + Intronic
923561049 1:235042155-235042177 TTTTTTTTTCTAATCATGAATGG - Intergenic
924544370 1:245011377-245011399 TTATTTTTTCACTTCATGAATGG - Intronic
924841833 1:247719294-247719316 TTCTGGTCACCATTCATGAATGG + Intergenic
924907068 1:248466959-248466981 TTATATTTTCAATCCATGATTGG - Intergenic
924917044 1:248581183-248581205 TTATATTTTCAATCCATGATTGG + Intergenic
924931999 1:248740222-248740244 CTCTGTTCTCAGTTCAGGAAGGG + Intronic
1062964390 10:1596033-1596055 TTCTGTGAACAAGTCATGAAGGG - Intronic
1064634735 10:17353010-17353032 TGCTGTTTACAATTCATACAGGG - Intronic
1064705206 10:18065211-18065233 TTTTGTTTTTTAATCATGAATGG + Intergenic
1064731537 10:18336166-18336188 TTTTGTTTTTAATTCATTAAAGG + Intronic
1065091091 10:22234394-22234416 TTCTGTTTAAAATAAATGAAAGG + Intergenic
1065197154 10:23277734-23277756 TTCTGTTTTCCTTTCATATATGG + Intronic
1065434524 10:25693346-25693368 TTTTGTTTTCAATTTTTAAATGG + Intergenic
1067710324 10:48645592-48645614 TTGTTTTTTAAAATCATGAATGG - Intronic
1067762869 10:49062502-49062524 TTCTGCTCTGAATCCATGAAGGG - Intronic
1068350271 10:55835470-55835492 TACTGTTTTAAATTAATTAAAGG - Intergenic
1068497123 10:57796827-57796849 TTCTGTTTCCAAAACATAAATGG + Intergenic
1068971289 10:62961118-62961140 TTCAGTTCTCAATTAATCAATGG + Intergenic
1069949828 10:72011130-72011152 TTCTGGTGTCCATGCATGAACGG - Exonic
1070260894 10:74854467-74854489 TTCTGTTTTTTTTTAATGAAAGG + Intronic
1070442805 10:76463310-76463332 TTTTGTTTGAAATTCAGGAAAGG + Intronic
1072036325 10:91566049-91566071 TTCTCTTTTAATTCCATGAATGG - Intergenic
1072157814 10:92739790-92739812 TTCATTTTTCATTTGATGAATGG + Intergenic
1072918685 10:99557231-99557253 TTCTTTTTTCTTATCATGAAAGG - Intergenic
1073894333 10:108137122-108137144 TTTTTTTTTCAATTCCTGGATGG - Intergenic
1074219207 10:111419902-111419924 ATCTGTTGTCAATTCAAGAGAGG - Intergenic
1074343336 10:112656082-112656104 TTCTGTTGTCAATTGAGAAAAGG + Intronic
1074349895 10:112726359-112726381 TTATGTTTTTATTTCTTGAAGGG + Intronic
1075039269 10:119094882-119094904 TTCTGTTTTCATTTCACATAAGG - Intergenic
1075172585 10:120129356-120129378 TTCTACTTTCTATTCATAAATGG - Intergenic
1076206766 10:128610082-128610104 TTCTCTTTTCATTTCCTCAAAGG + Intergenic
1078247424 11:9587505-9587527 TTCTGTTCTTATTTTATGAAAGG + Intronic
1078661873 11:13294121-13294143 TTTTCTTTTAACTTCATGAAGGG + Intronic
1080073144 11:28113983-28114005 TGGTGTTTTCAACTAATGAAGGG + Intronic
1080208752 11:29760693-29760715 TTCTGTTTTCAAAGCACGGAAGG - Intergenic
1080565903 11:33509237-33509259 TTCTGTTTGCAAACCATGGAGGG - Intergenic
1080720845 11:34847315-34847337 TTCTCTTTTCAATGAATCAATGG - Intergenic
1081183157 11:40009322-40009344 TACAGTTTTAAATTCATGACTGG + Intergenic
1081288258 11:41299545-41299567 ATCTGTTATAAATACATGAATGG + Intronic
1081416076 11:42817813-42817835 TTCTCTTAGCAATTCTTGAATGG - Intergenic
1086150591 11:83605861-83605883 TTCTGCTATCAAGCCATGAAAGG + Intronic
1086739194 11:90345581-90345603 TTCTGTTTACAAAACATGAATGG + Intergenic
1087002841 11:93438434-93438456 TTCTGTTTTTAATACAATAAAGG + Exonic
1087213226 11:95464642-95464664 TTGTGTTGTCTTTTCATGAATGG + Intergenic
1087970649 11:104477843-104477865 TTATGTTTTTCTTTCATGAAGGG - Intergenic
1089360172 11:117880308-117880330 GTCTTCTTTGAATTCATGAATGG + Intergenic
1090609598 11:128458409-128458431 TTCTGTATTCATATCAGGAACGG + Intergenic
1092388617 12:8055144-8055166 TATTCTTTTCATTTCATGAAGGG - Exonic
1094164589 12:27429589-27429611 TTTTATTGTCACTTCATGAATGG + Intergenic
1094227464 12:28062029-28062051 TCCTTTTTTCATTTCAAGAATGG + Intergenic
1095035612 12:37365600-37365622 ATCTGTGTTCAATTCACGAGTGG - Intergenic
1095275096 12:40272610-40272632 TTCTGTCTTCTATTCATGGATGG - Intronic
1095445831 12:42281260-42281282 TTCTGTTTTCATTTCAGGAAGGG - Intronic
1095714126 12:45323057-45323079 TTCTGTTTATAATTCTTTAATGG + Intronic
1095849878 12:46790795-46790817 TTGTGTTTTCAATACATGCTGGG - Intronic
1098867623 12:75780942-75780964 TTCTGTTTTGAGCTCATAAATGG + Intergenic
1099130720 12:78826960-78826982 TTCTGTTTTCAGTTCTTAAAAGG + Intergenic
1100519382 12:95358602-95358624 TTTTGTTTACATTTCAGGAATGG - Intergenic
1101102830 12:101410929-101410951 TTTTGTTTTCAATGCCTGTAGGG - Intergenic
1102179270 12:110899832-110899854 TTCTTTTTTAAAATCATGAATGG - Intronic
1102383674 12:112488542-112488564 TTCTGTTTTTAGTTTATGGAAGG + Intronic
1104587471 12:130059104-130059126 TACTGTTTCCAAGTCATGGATGG + Intergenic
1105333709 13:19443329-19443351 TTTTTTTTTTAAATCATGAATGG - Intronic
1105847113 13:24302759-24302781 TCCTGTTTTCATTTCCGGAAGGG - Exonic
1106030240 13:25994575-25994597 GTTTGTTTTTAACTCATGAATGG + Intronic
1106400684 13:29427200-29427222 TCCTGTTTTCCATTCCTTAAGGG + Intronic
1106439463 13:29753123-29753145 TTCTTTTTTTAATTTATAAATGG - Intergenic
1107181294 13:37462847-37462869 TTGTGTTTTCACTTTATGGATGG + Intergenic
1108102971 13:46977436-46977458 TTCTGTTTTTAATTTTTGCAGGG + Intergenic
1108123487 13:47215038-47215060 TACTGTTTTCAGCCCATGAAAGG - Intergenic
1108296491 13:49024678-49024700 TTTTTTTTTAAAATCATGAAGGG - Intronic
1108789399 13:53949518-53949540 TTCTATTTGCATTTCATGTAAGG + Intergenic
1109128003 13:58542867-58542889 TCCTTATTTCCATTCATGAAGGG - Intergenic
1109355176 13:61225328-61225350 TTGTATTTAAAATTCATGAAAGG - Intergenic
1110618564 13:77569607-77569629 TCTTGTTTTCAATTCCTGTAGGG + Intronic
1110806527 13:79760824-79760846 TTTTGTTTTTTAATCATGAAGGG + Intergenic
1110878463 13:80540122-80540144 TTTTTTTTTTAAATCATGAAGGG + Intergenic
1111359136 13:87151255-87151277 TTCTGTTTTTAATTCTAGACAGG - Intergenic
1112292460 13:98156881-98156903 TTATGTTTTCCTTTCCTGAAAGG + Intronic
1112429280 13:99336280-99336302 TTGTGTTTTCATTTCATTTATGG + Intronic
1112466389 13:99648743-99648765 TTCTATTATCAGTTCAAGAAAGG - Intronic
1112526103 13:100148765-100148787 TCCTGTTTTCATTTCACAAAAGG - Intronic
1112676499 13:101708147-101708169 TTCTGTATACTATTCTTGAAGGG + Intronic
1113308338 13:109103272-109103294 TTCTGTTTTTAATTAATACAGGG + Intronic
1114759317 14:25295501-25295523 TTCTTTTTTCAATTTTTTAAAGG - Intergenic
1115188171 14:30716505-30716527 ATCTGTTTGTAATTCAAGAAAGG + Intronic
1115513637 14:34163289-34163311 TTTTTTTTTTAAGTCATGAATGG - Intronic
1117119346 14:52552119-52552141 TTCTCTTTTCGCTGCATGAACGG - Intronic
1117586171 14:57208209-57208231 TTCTGTTTTCCATTAATAATAGG - Exonic
1117763923 14:59060531-59060553 TTCTGTTTTAATTTGATGAATGG - Intergenic
1118738289 14:68718314-68718336 TTGTATTTTTAATTCATAAATGG + Intronic
1118804099 14:69220021-69220043 TTTTTTTTTTAAATCATGAATGG + Intronic
1119742085 14:77020413-77020435 TTCTAACCTCAATTCATGAATGG + Intergenic
1120099532 14:80428444-80428466 TACTTTTTTAAAATCATGAAAGG + Intergenic
1120195583 14:81478826-81478848 TTCAGTTTTAGATTCAAGAATGG - Intronic
1120950157 14:90033461-90033483 TGATATTTTCAATTCATGAGGGG - Intronic
1122435953 14:101698776-101698798 TTTTTTTTTCAAATCATGAAAGG - Intergenic
1124553346 15:30703569-30703591 TTCTATTCTTATTTCATGAAGGG + Intronic
1124574269 15:30894246-30894268 TTCTATTTTCAACTGATGATGGG + Intergenic
1124677899 15:31702099-31702121 TTCTATTCTTATTTCATGAAGGG - Intronic
1124862522 15:33456523-33456545 TTCTGTCTTGAATTCCTGAGAGG + Intronic
1125646046 15:41273675-41273697 TTTTTTTTTTAAATCATGAATGG - Intronic
1125889417 15:43254512-43254534 TTCTGTTTTCAAATTTTCAAAGG + Intronic
1126091188 15:45053574-45053596 TTTTGTTTACAATTTATGACAGG + Intronic
1128496812 15:68203340-68203362 TTCTTTTTCCAATGAATGAATGG + Intronic
1129919456 15:79307748-79307770 CGATGTTTTCAATTCATGATAGG + Intergenic
1130748489 15:86683363-86683385 TTCTCTTTTCAATTCACCATGGG - Intronic
1131504958 15:93009378-93009400 TTCTGTTTTCTTTTAATAAAAGG + Intronic
1133550592 16:6850975-6850997 GTATGTTTTCAGTGCATGAATGG + Intronic
1134319766 16:13151948-13151970 ATTTGTTTTCAATGAATGAATGG + Intronic
1135738322 16:24951651-24951673 ATCTGTTTACTATTCATTAAGGG - Intronic
1137776218 16:51056518-51056540 TTATGTTTACAATTCCTAAAGGG - Intergenic
1138005716 16:53335033-53335055 TTCTATTTTTTAATCATGAAAGG - Intergenic
1138014445 16:53415996-53416018 TTCTATTTTCAACTGATGATGGG - Intergenic
1138377445 16:56575510-56575532 TTCTGTTTTTATTTTATGAGTGG + Intergenic
1139622400 16:68156631-68156653 TGCTTTTTTTAAATCATGAAAGG - Intronic
1140971190 16:80014400-80014422 TTCTGTTTACCATTTATAAAGGG + Intergenic
1141350573 16:83291161-83291183 GGCTGTTCTCAATTAATGAATGG + Intronic
1143996262 17:11008989-11009011 TTCATTTTTCAATTCTTGAAAGG - Intergenic
1145084572 17:19926264-19926286 TTTTTTTTTTAAATCATGAAAGG - Intronic
1145199008 17:20923023-20923045 TTCCTTTTTCAATTATTGAATGG - Intergenic
1146612200 17:34317123-34317145 TTTTTTTTTTAAATCATGAATGG - Intergenic
1146633873 17:34489968-34489990 TTCTGTTGACAAATCAGGAAAGG + Intergenic
1147891408 17:43720082-43720104 TTCTGTTTAGAATTTCTGAATGG + Intergenic
1148162373 17:45458075-45458097 TTCTGTTTTCCATTGCTAAAGGG - Intronic
1149149819 17:53547945-53547967 TTTTGTTTTCAAGGCTTGAAGGG - Intergenic
1150187559 17:63200489-63200511 TTCTCTATTCTATTAATGAATGG + Intronic
1150370056 17:64629685-64629707 TTCTGGTTTTAATCCATTAAAGG - Intronic
1150393608 17:64804736-64804758 TTCTGTTTTCCATTGCTAAAGGG - Intergenic
1153094821 18:1388888-1388910 TTCTGTTTTCAGCTCTTTAAGGG - Intergenic
1153123144 18:1756271-1756293 CTATCTTTTCAACTCATGAATGG - Intergenic
1155047346 18:22114367-22114389 TTCTGTTTCCAGTTCATCAACGG - Intergenic
1155280734 18:24237074-24237096 TTTTTTTTTTAAGTCATGAATGG - Intronic
1155751241 18:29424470-29424492 GTATGTTTTCAATTCCTGAGAGG + Intergenic
1155770017 18:29684714-29684736 TTCTGTTTTCAGCTCTTTAAAGG - Intergenic
1156795250 18:41036961-41036983 TTTTGTATTCAATTCATTCATGG + Intergenic
1156868919 18:41921577-41921599 TGCCGTTTTCAATTCATACAGGG + Intergenic
1156935028 18:42693703-42693725 TTCTGTTTTAAAGTCTTTAAGGG + Intergenic
1158062143 18:53357412-53357434 TTCTGTATTCCATGCATGAAGGG - Intronic
1159350151 18:67261593-67261615 TACTATTTTCAAGTGATGAAGGG + Intergenic
1159774448 18:72586571-72586593 ATCTCATTTTAATTCATGAACGG + Intronic
1159862188 18:73662469-73662491 TTATGGTTTCAACTGATGAAAGG + Intergenic
1160237603 18:77098560-77098582 GCCTGTTTTTAATTCATGAGTGG - Intronic
1161797767 19:6397065-6397087 CTTTATTTGCAATTCATGAATGG - Intergenic
1163978368 19:20874411-20874433 TTCTTTTTTCAATGAATGAATGG - Intergenic
1164188292 19:22892539-22892561 TTCTTTTTTAATTTCCTGAAAGG + Intergenic
1166021052 19:40029969-40029991 TGATGTTTTCAATTTATGATGGG - Exonic
925740092 2:6997720-6997742 TTCTTTTTTCATTCCTTGAATGG - Intronic
928644495 2:33337749-33337771 ATATGTTTTCACTTAATGAAGGG - Intronic
928716487 2:34066885-34066907 TTCAGTTTTCATTTGAAGAAAGG + Intergenic
928755388 2:34518331-34518353 TGCTGTTTTAAATTAATGAGAGG - Intergenic
929271496 2:39977232-39977254 TTCTGTTTAAAACTCATTAATGG - Intergenic
929408882 2:41674149-41674171 TACTGTTTGAAATTCATCAATGG - Intergenic
930399697 2:50867447-50867469 TTTTGTTTTTAATCCATTAAAGG - Intronic
930531566 2:52595252-52595274 TTCTGTGTTCCCTTCATGTAGGG + Intergenic
930734162 2:54758195-54758217 TATTGTTTTCAAGTCCTGAAGGG + Intronic
930981673 2:57533200-57533222 CTCTTTTATCAATTCATAAAAGG - Intergenic
931210345 2:60188337-60188359 TTTTTTTTTTAAATCATGAATGG - Intergenic
932226027 2:70041458-70041480 TTTTTTTTTCAATCCTTGAATGG - Intergenic
933030468 2:77322452-77322474 TTCTGCTTTCACTACATGATAGG + Intronic
933202138 2:79463496-79463518 TTCTGTTTAAAATTCATATATGG + Intronic
933213770 2:79602339-79602361 TTTTTTTTTTAAATCATGAATGG - Intronic
933330989 2:80892989-80893011 ATCTCTTTTCAATTCCTGCATGG - Intergenic
934121653 2:88846005-88846027 TTCTGTTTTCAGTTCCCCAAAGG + Intergenic
935073676 2:99719135-99719157 TTTTCTTTTTAAATCATGAATGG + Intronic
935231649 2:101103306-101103328 TTTTTTTTTAAAATCATGAATGG - Intronic
935478278 2:103552847-103552869 TTCTTTTTTTAAATCATGAAGGG + Intergenic
935525959 2:104167578-104167600 TTCACTCTTAAATTCATGAAAGG + Intergenic
935933977 2:108161578-108161600 CTCTGTTTTCAGTTCAGAAAAGG + Intergenic
936441791 2:112560585-112560607 TTCTGTCTCCAAATCATAAATGG - Intronic
936452970 2:112646765-112646787 TTCTGTTTACACATCTTGAAAGG + Exonic
936641811 2:114321320-114321342 TTCTGGTTACAATGCATGAGGGG - Intergenic
936905537 2:117532042-117532064 TTATGTTTTCAATTCAAGCTAGG + Intergenic
937174263 2:119911447-119911469 TTATTTTTTTAAATCATGAATGG - Intronic
937902020 2:127026784-127026806 CTCTGTTTTCAGTTCGTGACTGG - Intergenic
939270008 2:139927207-139927229 TTCTGTTTCCAATTCATCTTTGG + Intergenic
940028531 2:149235244-149235266 TTCTGTTTCCCATTCACAAACGG - Intergenic
940725808 2:157334861-157334883 TTTTGTGTTGAATTCAAGAAAGG + Intergenic
941945793 2:171095784-171095806 TTTTTTTTTTAAATCATGAAAGG - Intronic
942428744 2:175886781-175886803 TTATCTTTTCAAATCAGGAAAGG - Intergenic
942494321 2:176523338-176523360 TTCTGATTAGAATTCATAAAAGG - Intergenic
942529482 2:176894042-176894064 TTCTGTTTTGGAATGATGAAGGG - Intergenic
942765180 2:179446833-179446855 TTCTATTTTTAATTCATCTATGG - Intronic
943471243 2:188295900-188295922 TTCTTATTTCCATTGATGAATGG + Intronic
944292768 2:198026510-198026532 ATCTGTCTTCAATCCATGATAGG - Intronic
944462701 2:199968294-199968316 CTCTTTTATCAATTAATGAAAGG - Intronic
945231889 2:207599693-207599715 TTCTTTTTTTAATGCAAGAATGG + Exonic
945537399 2:211035791-211035813 ATCTGTTTACATTTCCTGAAAGG - Intergenic
945560319 2:211331215-211331237 TTCTGTTTTGGATTCCTGGAAGG - Intergenic
945713110 2:213325177-213325199 TTGTGTCTTTAATTTATGAATGG + Intronic
945792626 2:214324403-214324425 TTCTGTTTTCAAACCACAAAAGG + Intronic
945966779 2:216196111-216196133 TTCAATTTTCAACTCAAGAAAGG + Intronic
946999533 2:225437874-225437896 TTCTATATGCAATTTATGAATGG + Intronic
1168970486 20:1927498-1927520 ATCTGTTTTCAAGCCACGAAGGG + Intronic
1169188084 20:3636439-3636461 TTTTGTTTTCAAATTAGGAATGG - Intronic
1169330285 20:4710772-4710794 TTCTTTTTTCTGTTCATCAAAGG - Intergenic
1170595564 20:17803056-17803078 TTCTGTTTTCAAGCCACAAAGGG - Intergenic
1173732660 20:45339427-45339449 TTCTGTTGTGTGTTCATGAAAGG - Intronic
1174745127 20:53054311-53054333 TTCAGTTTTCAATTGATGCTTGG + Intronic
1176739347 21:10585297-10585319 TTTTTTTTTTAAATCATGAATGG + Intronic
1176938922 21:14900257-14900279 AACTGTTTTCCTTTCATGAAAGG + Intergenic
1178192103 21:30295300-30295322 TTATATTTTATATTCATGAATGG + Intergenic
1178693837 21:34775708-34775730 TTCTGTTTTACTTTGATGAAGGG + Intergenic
1178746663 21:35257942-35257964 TGCTGTTTTTATTTCTTGAAAGG + Intronic
1179296442 21:40066996-40067018 TTATATTTTCAATTGATGATGGG - Intronic
1181104731 22:20567455-20567477 TTCTGTTTGTGATTCATGAGTGG + Intronic
1181286507 22:21756304-21756326 TACTGATTTCATTTCATAAAAGG + Exonic
1182037435 22:27210378-27210400 TTTTGTTTTCAATTCAATTAAGG - Intergenic
1182909342 22:33968141-33968163 TTCTGTTTGCAAATCAAGCAAGG + Intergenic
1183138869 22:35917073-35917095 TGCTGTTTACCATTCATGATGGG - Intronic
1183174786 22:36215153-36215175 TTTTGTTTTCCTTTCATGAGGGG - Intergenic
1183265133 22:36820218-36820240 ATCTCTTTGCAAATCATGAAGGG - Intergenic
1184284045 22:43456805-43456827 ATGTGTTTTTAAATCATGAAAGG + Intronic
1185387445 22:50541698-50541720 TTATGTTTTCAATTTAAGCAAGG - Intergenic
949273665 3:2252498-2252520 TTCTTTTTCTTATTCATGAATGG - Intronic
949438926 3:4059388-4059410 TTAAGTTTTCAATTCCAGAATGG - Intronic
949631308 3:5929688-5929710 TTCTTTTTGCAATTCCTGTAAGG + Intergenic
949902963 3:8834975-8834997 TTCTGGTTTCAGTAGATGAATGG - Intronic
949915236 3:8956738-8956760 TTTTTTTTTTAAATCATGAATGG - Intronic
950314757 3:11991495-11991517 TTTTCTCCTCAATTCATGAAAGG + Intergenic
951284827 3:20797379-20797401 TTATGTTTTCAATATATGATTGG - Intergenic
951339790 3:21470968-21470990 TTCTATTTTCAATACTTAAAGGG + Intronic
951406708 3:22309105-22309127 TTCTGTTTTAAATTCGTTAGTGG - Intronic
951692878 3:25415593-25415615 TTGTGTTTTTAACTCATGAATGG - Intronic
951971297 3:28447450-28447472 TTTTTTTTTTAAATCATGAAAGG - Intronic
952060002 3:29496404-29496426 TTTTGTTTTCATTTCAGAAAAGG + Intronic
953273808 3:41474935-41474957 TTCTGTTTTTAATTTTTTAAAGG - Intronic
954348294 3:50019800-50019822 TTTTTTTTTTAAATCATGAAAGG + Intronic
956424832 3:69123271-69123293 TTTTGTTTTCAAACCCTGAAGGG + Intergenic
957164922 3:76660058-76660080 TTCTGTCTTCATTTTATTAATGG - Intronic
957248496 3:77742697-77742719 TAATGTTTTCAGTTCAGGAAGGG - Intergenic
957421274 3:79974798-79974820 CTCATTTTCCAATTCATGAAGGG - Intergenic
957533466 3:81470586-81470608 CTCTGTTTTGCAGTCATGAAGGG + Intergenic
958170238 3:89930434-89930456 ATCTGTGTCCAATTCATGCATGG + Intergenic
958502193 3:94926178-94926200 TTTTATTTTTAATTCATGTATGG + Intergenic
959102946 3:102034179-102034201 TGCTGTTTTCAATCCATGTCTGG - Intergenic
959114440 3:102159389-102159411 TTCTATTTTTACTTCATTAAGGG - Intronic
959136631 3:102430910-102430932 TTATGATTACACTTCATGAAAGG + Intronic
959204436 3:103286938-103286960 TTCTGTTTGCAGTACAGGAAAGG - Intergenic
959795627 3:110424918-110424940 TTCTGTTTTTCATTAATGAAAGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960104815 3:113784118-113784140 TTCCGTTTTCACTTCTTGAGTGG + Intronic
960676253 3:120198256-120198278 TGGTGTTTACAATTCCTGAAGGG - Intronic
961268359 3:125667367-125667389 TTCTGTTTTATATCAATGAATGG - Intergenic
962220551 3:133561160-133561182 TTTTGTTTGCATTTCATGATTGG - Intergenic
962801085 3:138891166-138891188 TTCTGTTTTTAATTTTTTAAAGG - Intergenic
963574101 3:147037664-147037686 GTTTTTTTTTAATTCATGAATGG - Intergenic
963869867 3:150404315-150404337 TTCTTTTTTCAATTAACAAATGG + Intergenic
964113533 3:153111921-153111943 TTCTATTTTCAACTAATTAAAGG - Intergenic
964187023 3:153958390-153958412 TTCTAATTTCACATCATGAATGG + Intergenic
964209728 3:154213621-154213643 TTTTCTTTTCATTTTATGAAGGG + Intronic
965016006 3:163157266-163157288 TTCTGTTATCAATAAATGTATGG - Intergenic
965141828 3:164847633-164847655 TTATTTTTTTAATTCAAGAAGGG + Intergenic
966225119 3:177590004-177590026 TTCTGTTCTGAATCCATGAGTGG + Intergenic
967403490 3:189089730-189089752 TTATTTCATCAATTCATGAATGG + Intronic
967960329 3:194916069-194916091 TTTTGTTTTTTAATCATGAATGG + Intergenic
968628839 4:1639832-1639854 TTCTCAATACAATTCATGAAAGG - Intronic
969389577 4:6881197-6881219 TTGTGTTGTCAAATCAAGAATGG + Exonic
970648292 4:18148028-18148050 TTCTATTTACAATTCATCACAGG + Intergenic
970847273 4:20555233-20555255 TTAGGTTTTCAAATCATGGAAGG - Intronic
971191702 4:24434787-24434809 TTCTTTTGTCCATTCATGACAGG + Intergenic
971237873 4:24859346-24859368 TAATGTTTTCAATTTATGATGGG + Intronic
972098834 4:35385542-35385564 TTCTGTTTTGAATACCTGAAGGG - Intergenic
972446209 4:39146406-39146428 ATCTGTTTTCAATTCTTTGAAGG + Intergenic
974452128 4:62078472-62078494 TTATATTTCCAATGCATGAAGGG - Intergenic
974609334 4:64195179-64195201 TTGTGTTCTCCATTCATGTAGGG + Intergenic
974731129 4:65867841-65867863 TTATTTTTTCACTGCATGAACGG - Intergenic
977362221 4:96020589-96020611 TTTTGTTTTAAATTTTTGAAAGG + Intergenic
978169941 4:105658141-105658163 TTCTGTTTTAAATACATTAAAGG - Intronic
978821601 4:112972909-112972931 TTTGGTTTTCCATTCCTGAATGG - Intronic
978989262 4:115057990-115058012 ATATGTTTTAAAATCATGAAAGG + Intronic
980114737 4:128668365-128668387 TAATATTTTTAATTCATGAAAGG - Intergenic
980713866 4:136607273-136607295 TTACGTTTTTCATTCATGAAAGG - Intergenic
981345272 4:143668545-143668567 GTTTGGCTTCAATTCATGAAAGG + Intronic
982053312 4:151525369-151525391 TTGTATTTTCAATTCCTGAGAGG + Intronic
982292737 4:153794985-153795007 TTCTGTTATCAATTCTTGTCTGG + Intergenic
982338400 4:154267095-154267117 TTCTGGTTTTAATTCATGCATGG + Intronic
982948009 4:161651318-161651340 TTTTTTTTTCAATTCAAGGAAGG - Intronic
983599756 4:169513760-169513782 TTATTTTTTTAAATCATGAATGG + Intronic
984226298 4:177039416-177039438 TTCTATTTTCAACTCTTCAAAGG - Intergenic
985110197 4:186540353-186540375 TTGTATTTTCAATCCATGATTGG + Intronic
985852050 5:2396022-2396044 TTCTGTTTTCAAGTCATGTCGGG + Intergenic
986871367 5:12050503-12050525 TTCAGTTTTCAATGCACTAAAGG + Intergenic
986971100 5:13337770-13337792 TTCTGTTTTCATTTTGTGATTGG + Intergenic
987747897 5:22000710-22000732 TTCTGTCTTCAAGTGATGATCGG + Intronic
987976213 5:25018365-25018387 TACTCTTTTTACTTCATGAAAGG + Intergenic
988285047 5:29203589-29203611 TTTTGTTTGCAATTCTTTAAAGG + Intergenic
988285477 5:29210674-29210696 TTCTGTTTTAAATGAATAAAAGG - Intergenic
988386401 5:30571683-30571705 TTTTGTTTTCAATTTGTGAAAGG - Intergenic
988571519 5:32372018-32372040 TTCAGGTTTCAATCCAAGAATGG - Intronic
988964872 5:36405912-36405934 CTCTGTTTTAAATTCTTCAACGG + Intergenic
989300722 5:39889303-39889325 TAGTATTTTCAATTCATGATTGG + Intergenic
989788882 5:45367779-45367801 TTTTGTTTTGTATTGATGAATGG - Intronic
989802215 5:45556857-45556879 TTCTGTTGGCAATTCAGGGAGGG - Intronic
990400490 5:55432788-55432810 TTTTTTTTTTAAATCATGAAGGG - Intronic
990742373 5:58925244-58925266 TTCAGTTTAAAGTTCATGAATGG + Intergenic
990799677 5:59586562-59586584 TTCTTTTTTCAAATCCTGGAAGG - Intronic
991218040 5:64178534-64178556 TGCTGTTTTTATTTCTTGAAAGG + Intronic
991768074 5:70010500-70010522 TTCTGTCTTCAAGTGATGATCGG + Intergenic
991847311 5:70885582-70885604 TTCTGTCTTCAAGTGATGATCGG + Intergenic
992261300 5:74973287-74973309 TTTTGTTTGTAATTCATGAATGG + Intergenic
992458126 5:76934966-76934988 GTATCTTTTCACTTCATGAAAGG - Intergenic
992633412 5:78703188-78703210 TTCTGTTTTATATTCAGAAATGG - Intronic
992954855 5:81897290-81897312 TTCTGTTTACAATAGCTGAAAGG - Intergenic
993125631 5:83832460-83832482 TGCTCTTTTCTATTCTTGAAAGG - Intergenic
994777624 5:104054841-104054863 TTCTGTCTGCAAGTCAGGAAGGG + Intergenic
995029146 5:107460033-107460055 TTCTGGTTTAAAATCAGGAAAGG + Intronic
995178042 5:109201081-109201103 TACTGATTTCAGTTCATTAATGG - Intergenic
995929168 5:117415271-117415293 TTCTTTTATCAAGTCATGATTGG - Intergenic
996481274 5:123977828-123977850 TTCTGTTTTCTCATCTTGAATGG - Intergenic
997045467 5:130311603-130311625 TTCTTTTTTCTGTTCCTGAAGGG + Intergenic
997109098 5:131054551-131054573 TTCTGTTTTGAAGTCAGGATAGG - Intergenic
997448356 5:133960349-133960371 CTCTGTTTTCATTTCATAAAGGG + Intronic
998008382 5:138672883-138672905 TTCTGATTTCATTTCCTTAATGG + Intronic
998140198 5:139695590-139695612 ATGTGTTTTCAGTCCATGAATGG + Intergenic
998715352 5:144877624-144877646 TTCTCTGTTCATTTCATGTATGG + Intergenic
999853662 5:155569915-155569937 TTCTGTTTTAAGTTCTTGAGAGG + Intergenic
1000398260 5:160798409-160798431 ATCTGTTTTCTCTTCTTGAAAGG - Intronic
1000687526 5:164271029-164271051 TTCTGTTTTAAATTTTTTAATGG + Intergenic
1000960009 5:167588818-167588840 TTCTGTTTTTCATTTATGATTGG + Intronic
1002009066 5:176262267-176262289 TTTTTTTTTTAAATCATGAATGG - Intronic
1002217656 5:177650011-177650033 TTTTTTTTTTAAATCATGAATGG + Intergenic
1002676842 5:180923482-180923504 TTCTGTTGCTAATTCATAAAAGG - Intronic
1002825929 6:774330-774352 TTATGTTTTTAATAGATGAAGGG + Intergenic
1003956243 6:11167787-11167809 TTTTGTTTTCAATTTCAGAATGG + Intergenic
1005127764 6:22467961-22467983 TCCTGTTCTCAATTCAAGACTGG + Intergenic
1005573205 6:27167022-27167044 TTATGTTCTCCATTCATGTATGG - Intergenic
1008193479 6:48488994-48489016 TTCTTTTTTAAATTTGTGAAGGG - Intergenic
1008646977 6:53524434-53524456 TTATGCTTTCATTTCATGGAAGG + Intronic
1009923646 6:70094231-70094253 TTCTTTTTTAACTTCATGAAAGG - Intronic
1010739664 6:79485507-79485529 TTCTGTTCCCAATAAATGAAAGG + Exonic
1014933104 6:127356871-127356893 TTTTGTTTACAATTTATGAGAGG + Intergenic
1015099095 6:129453498-129453520 TGCTATTTTCATTTCATTAACGG - Intronic
1015469355 6:133586191-133586213 TTCTGCTTACATTTCATTAATGG + Intergenic
1016266732 6:142241277-142241299 TTCTCTTTTGACTTCTTGAAAGG - Intergenic
1016353526 6:143193712-143193734 TTCTGTTTACCACTCATAAATGG + Intronic
1016746250 6:147583079-147583101 TCCTGTTTTTATTTAATGAAAGG - Intronic
1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG + Intronic
1018264057 6:162001858-162001880 TTTTTTTTTTAAATCATGAATGG + Intronic
1018280165 6:162176956-162176978 TTTTGCTTTCATTTTATGAAAGG - Intronic
1019065559 6:169293345-169293367 TTCTGTTTTGTTTTCATGTAAGG - Intergenic
1019109218 6:169696605-169696627 TTTTGTTTTTAAGACATGAAGGG - Intronic
1020503572 7:8954574-8954596 TATTATTTTTAATTCATGAAGGG - Intergenic
1021702507 7:23333672-23333694 TTCTGTTTTCATTCCAGGATAGG - Intronic
1021973419 7:25986928-25986950 TTCTATTTTGCATTCATCAAAGG - Intergenic
1022971552 7:35522253-35522275 TTCTGACTTCCATTTATGAATGG - Intergenic
1023167803 7:37360088-37360110 TTACCTTTTCACTTCATGAATGG + Intronic
1023705740 7:42940137-42940159 TTCTGTTTTCAATTCATGAATGG + Intronic
1024115973 7:46193769-46193791 TTTTTTTTTTAAATCATGAATGG + Intergenic
1024569562 7:50712684-50712706 TTTTGCTTTTAATTCAAGAATGG - Intronic
1024756103 7:52533468-52533490 TGATATTTTCAATTCATGATGGG + Intergenic
1024862461 7:53861712-53861734 TGCAGTTTTCAACTCCTGAAGGG + Intergenic
1026401417 7:70017497-70017519 TTATGCTGTCATTTCATGAAAGG + Intronic
1027301762 7:76845626-76845648 TTCCATTTTCAGTTCATGGAAGG + Intergenic
1027813406 7:82935892-82935914 TTCTGTTTTCTATTTTTGATTGG - Intronic
1028135095 7:87216846-87216868 TTCACTATTCAACTCATGAAAGG + Intronic
1028619532 7:92809736-92809758 TTCTGTTTTTAATTAGTTAATGG - Intronic
1029694881 7:102206026-102206048 TTGTGTTTTCAATGAATCAATGG - Intronic
1030629920 7:111884667-111884689 TTATGTCTTCAAATCATGCAGGG + Intronic
1030755108 7:113278280-113278302 TTCTGTCATCATTTGATGAAAGG + Intergenic
1031706480 7:124986173-124986195 TTTTGTTTTCAAACCATGCACGG - Intergenic
1031723982 7:125213374-125213396 TTTTTTTTTCAATTCAAGCAAGG + Intergenic
1032336112 7:131026322-131026344 CTCTCATTTCTATTCATGAATGG + Intergenic
1032509568 7:132461531-132461553 TCCAGTTTTCAATGCAGGAAAGG - Intronic
1032812063 7:135430075-135430097 TTCTTTTCTAAATTCATGATTGG - Intronic
1032828606 7:135597765-135597787 TTCTGTTTTAAATTCAAGTTTGG + Intronic
1035488035 7:159244669-159244691 TTCTCTTTTCTTTTCAGGAAAGG - Intergenic
1035556605 8:571881-571903 TTCTGTTTTTCATTCAGAAAGGG - Intergenic
1035671302 8:1419479-1419501 TTTTGTTTTCATTTTATAAATGG + Intergenic
1038679587 8:29654322-29654344 TTCTGTTTTTAATTACTGGAAGG + Intergenic
1038899306 8:31824395-31824417 AACTGCTTTCAATTCCTGAAGGG + Intronic
1039240068 8:35546564-35546586 TTCATTGTTCAATTCATAAAAGG - Intronic
1040108970 8:43557518-43557540 TTCTTTCTTGACTTCATGAATGG + Intergenic
1040463049 8:47668459-47668481 TTTTTTTTTTAAATCATGAATGG - Intronic
1041131769 8:54709352-54709374 TTCTGTTTTCCCTTCCTGAAGGG + Intergenic
1041641649 8:60209105-60209127 TTCTGTTGTCATTTCTTGAAAGG - Intronic
1043178711 8:77056121-77056143 TTCTGTTTGCTATGTATGAATGG - Intergenic
1043921064 8:85983854-85983876 TTCTGTTTCCAATTTAGGCATGG - Intergenic
1044272059 8:90257290-90257312 TGCTTTTTTAAATTCATGAATGG - Intergenic
1044652103 8:94507014-94507036 TTCTGTTTTCAATAGGTTAAAGG + Intronic
1044863312 8:96544726-96544748 TTTTGTTTTAAATAAATGAATGG + Intronic
1045202299 8:99996309-99996331 TACTGTTTTTAATTGATGAATGG - Intronic
1045336762 8:101211644-101211666 TTCTGTTTTCTTTTCTTCAATGG - Intergenic
1045903945 8:107320103-107320125 TACTTTTTTCACTTCCTGAATGG + Intronic
1045918722 8:107504448-107504470 TTCTTTTTTTAACTCATGAGTGG - Intergenic
1046024077 8:108701185-108701207 TTTTTTTTTTAAGTCATGAATGG - Intronic
1046144381 8:110138784-110138806 TTATGTGATCAATTCTTGAAAGG + Intergenic
1048633160 8:136266498-136266520 TTCTCTTTTTAATTTTTGAAAGG + Intergenic
1048655679 8:136533402-136533424 TTCTGTGGTCAATTCAAGGACGG - Intergenic
1050031000 9:1385500-1385522 TTCTGTTTGCAAATCAAGCAAGG - Intergenic
1050126789 9:2364964-2364986 TTCTGATTCCATTTCATTAATGG - Intergenic
1050667403 9:7956360-7956382 TGCTGTTTTCTTTCCATGAATGG + Intergenic
1050668198 9:7965734-7965756 TTCTGTTTTTAATTGTGGAAGGG + Intergenic
1050943781 9:11492365-11492387 AGCTGTTATCAATTCATTAATGG + Intergenic
1050972430 9:11894504-11894526 TTCTTTTTTTAATTTATGAAGGG + Intergenic
1051459688 9:17297082-17297104 TGATATTTTCAATTCATGATTGG - Intronic
1051494879 9:17709290-17709312 CTCTGTTTTCTATTCATGAGTGG - Intronic
1051846797 9:21460449-21460471 TCCTATTTTTAAATCATGAAAGG + Intergenic
1052436963 9:28442809-28442831 TTGTGATTTCAACTAATGAATGG - Intronic
1052751566 9:32497152-32497174 TTAAGTCTTTAATTCATGAATGG + Intronic
1053552241 9:39095512-39095534 TTTTGTTTTTCAATCATGAAAGG + Intronic
1053816368 9:41915668-41915690 TTTTGTTTTTCAATCATGAAAGG + Intronic
1054106629 9:61059352-61059374 TTTTGTTTTTCAATCATGAAAGG + Intergenic
1054354276 9:64046467-64046489 ATCTGTATTCAATTGATCAAGGG - Intergenic
1054614228 9:67271773-67271795 TTTTGTTTTTCAATCATGAAAGG - Intergenic
1056234573 9:84581077-84581099 TTTTATTTTTAAATCATGAATGG - Intergenic
1056293486 9:85167858-85167880 GTCTGTTTTCCATCTATGAAAGG - Intergenic
1056295223 9:85186303-85186325 TTCTATTTTGCATTCATGACAGG + Intergenic
1057519091 9:95746769-95746791 TGATGTTTTCAATTTATGATGGG - Intergenic
1057532385 9:95862418-95862440 TTTTTTTTTCTAATCATGAAAGG + Intergenic
1057621888 9:96643734-96643756 ATCTGTTATAAATTCATGAGAGG + Intronic
1058639756 9:107071848-107071870 TTCTATTTTCAACTCATTATTGG - Intergenic
1058912108 9:109530606-109530628 TTCTGTTTTTAATTCCTTGAGGG + Intergenic
1185598788 X:1325054-1325076 TTTTGTTTTCAACTCAGGACGGG - Intergenic
1186844247 X:13515345-13515367 GTCTATATTCAATTCATGCAGGG + Intergenic
1186966605 X:14793714-14793736 TTCTGTGTTCAACTCAAGATGGG - Intergenic
1187080682 X:15983708-15983730 TTATGTTTTCAAATCACAAATGG + Intergenic
1187444936 X:19352674-19352696 TTCTATTTTCAATACATGTGTGG + Intronic
1187565557 X:20446172-20446194 TTTTGTTTTAAATTCTTGTAGGG + Intergenic
1188229080 X:27638671-27638693 TTCAGTTTTCAATTCACAAGTGG + Intronic
1188784602 X:34329790-34329812 TACTGTTTTGAATTCATAATGGG - Intergenic
1189027699 X:37414639-37414661 ATCTGTTTTTATTTCATGATAGG + Intronic
1190768967 X:53499389-53499411 TTTTATTTTCAATTTATGATGGG - Intergenic
1190905625 X:54724456-54724478 TTCTTTTTCCAATCCATGATTGG + Intergenic
1192276725 X:69639251-69639273 ACCTGTTTTCAATTCATTTAGGG + Intronic
1194412275 X:93571782-93571804 TTTTGTTTTAAATTCTTTAAAGG + Intergenic
1194496851 X:94626737-94626759 TTATGTTTTCAGATCATGAATGG - Intergenic
1194817102 X:98455931-98455953 TTGTGTTTTCAATTTTTTAAAGG + Intergenic
1194964749 X:100274850-100274872 TTCAGTGTTCATTTCATCAAAGG + Intergenic
1195374586 X:104214453-104214475 ATATATTTTCAAATCATGAATGG - Intergenic
1195897988 X:109768011-109768033 TTTTTTTTTAAAATCATGAATGG - Intergenic
1196744078 X:119052895-119052917 TCCTGTTTTCTTTACATGAATGG + Intergenic
1197297782 X:124740053-124740075 TGCTTTTTTCACATCATGAAGGG - Intronic
1197466514 X:126810890-126810912 TTATGTTTTCAATTTATTCATGG + Intergenic
1197920328 X:131586052-131586074 TTGTGTTTTCATTTCCTGAATGG - Intergenic
1198140566 X:133798544-133798566 TTCTGTGTTGTATTCATAAAAGG - Intronic
1199374668 X:147093503-147093525 TTCTGATTTTTATTCATTAAAGG + Intergenic
1199993492 X:153003868-153003890 TGCTGTTTTCTATTCCTGGATGG - Intergenic
1201731314 Y:17206793-17206815 TTCTGTTTTAGAATCAGGAATGG + Intergenic