ID: 1023707717

View in Genome Browser
Species Human (GRCh38)
Location 7:42959700-42959722
Sequence ATTTTGTAGGGCTAACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023707714_1023707717 -10 Left 1023707714 7:42959687-42959709 CCAGGAAACATGCATTTTGTAGG No data
Right 1023707717 7:42959700-42959722 ATTTTGTAGGGCTAACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023707717 Original CRISPR ATTTTGTAGGGCTAACAAGC AGG Intergenic