ID: 1023709224

View in Genome Browser
Species Human (GRCh38)
Location 7:42974248-42974270
Sequence CAGTTTGCACTGTGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023709220_1023709224 7 Left 1023709220 7:42974218-42974240 CCTAATGTAGAAACATGAATAAT No data
Right 1023709224 7:42974248-42974270 CAGTTTGCACTGTGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023709224 Original CRISPR CAGTTTGCACTGTGTGAGGA TGG Intergenic
No off target data available for this crispr