ID: 1023713153

View in Genome Browser
Species Human (GRCh38)
Location 7:43016036-43016058
Sequence CTCTGTCCACCCAACAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023713148_1023713153 25 Left 1023713148 7:43015988-43016010 CCAAAGAGCCAGTTACAATTAGG No data
Right 1023713153 7:43016036-43016058 CTCTGTCCACCCAACAAGTTTGG No data
1023713147_1023713153 26 Left 1023713147 7:43015987-43016009 CCCAAAGAGCCAGTTACAATTAG No data
Right 1023713153 7:43016036-43016058 CTCTGTCCACCCAACAAGTTTGG No data
1023713151_1023713153 -7 Left 1023713151 7:43016020-43016042 CCTAATTTATTTCCATCTCTGTC No data
Right 1023713153 7:43016036-43016058 CTCTGTCCACCCAACAAGTTTGG No data
1023713150_1023713153 17 Left 1023713150 7:43015996-43016018 CCAGTTACAATTAGGTTAGTAAA No data
Right 1023713153 7:43016036-43016058 CTCTGTCCACCCAACAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023713153 Original CRISPR CTCTGTCCACCCAACAAGTT TGG Intergenic
No off target data available for this crispr