ID: 1023713387

View in Genome Browser
Species Human (GRCh38)
Location 7:43018604-43018626
Sequence CTTAGTCATCTCTAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023713385_1023713387 -6 Left 1023713385 7:43018587-43018609 CCATAGGCCAAAACATTCTTAGT No data
Right 1023713387 7:43018604-43018626 CTTAGTCATCTCTAAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023713387 Original CRISPR CTTAGTCATCTCTAAGAGCA AGG Intergenic
No off target data available for this crispr