ID: 1023714881

View in Genome Browser
Species Human (GRCh38)
Location 7:43033757-43033779
Sequence CAGTGAGAATGTAAAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023714880_1023714881 16 Left 1023714880 7:43033718-43033740 CCACATGAGATTTGGCGGGCTCA No data
Right 1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023714881 Original CRISPR CAGTGAGAATGTAAAGAAAT TGG Intergenic
No off target data available for this crispr