ID: 1023716136

View in Genome Browser
Species Human (GRCh38)
Location 7:43046303-43046325
Sequence AGTGACAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023716131_1023716136 24 Left 1023716131 7:43046256-43046278 CCAGCAGTGGCTGCATGGTACAG No data
Right 1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG No data
1023716128_1023716136 27 Left 1023716128 7:43046253-43046275 CCCCCAGCAGTGGCTGCATGGTA No data
Right 1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG No data
1023716129_1023716136 26 Left 1023716129 7:43046254-43046276 CCCCAGCAGTGGCTGCATGGTAC No data
Right 1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG No data
1023716130_1023716136 25 Left 1023716130 7:43046255-43046277 CCCAGCAGTGGCTGCATGGTACA No data
Right 1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023716136 Original CRISPR AGTGACAGCACAGTGATTGT GGG Intergenic
No off target data available for this crispr