ID: 1023718874

View in Genome Browser
Species Human (GRCh38)
Location 7:43072595-43072617
Sequence CTTTTTAAGCAGCCAGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023718870_1023718874 -2 Left 1023718870 7:43072574-43072596 CCCGGACAAAGAAAACAGCCACT No data
Right 1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG No data
1023718869_1023718874 -1 Left 1023718869 7:43072573-43072595 CCCCGGACAAAGAAAACAGCCAC No data
Right 1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG No data
1023718871_1023718874 -3 Left 1023718871 7:43072575-43072597 CCGGACAAAGAAAACAGCCACTT No data
Right 1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG No data
1023718868_1023718874 14 Left 1023718868 7:43072558-43072580 CCAGGAAAGTCTGAGCCCCGGAC No data
Right 1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023718874 Original CRISPR CTTTTTAAGCAGCCAGTGGC CGG Intergenic
No off target data available for this crispr