ID: 1023723080

View in Genome Browser
Species Human (GRCh38)
Location 7:43114552-43114574
Sequence CAGAGGAAGCAGCAAGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 393}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023723080_1023723087 28 Left 1023723080 7:43114552-43114574 CCCTCCGCTTGCTGCTTCCTCTG 0: 1
1: 0
2: 4
3: 49
4: 393
Right 1023723087 7:43114603-43114625 ATTTTAATTCCTAGACCTCCAGG No data
1023723080_1023723085 -9 Left 1023723080 7:43114552-43114574 CCCTCCGCTTGCTGCTTCCTCTG 0: 1
1: 0
2: 4
3: 49
4: 393
Right 1023723085 7:43114566-43114588 CTTCCTCTGGAATGTGGCATTGG 0: 1
1: 0
2: 1
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023723080 Original CRISPR CAGAGGAAGCAGCAAGCGGA GGG (reversed) Intronic
900131655 1:1089774-1089796 CAGTGGGAGCAGCCAGGGGAGGG - Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
901852206 1:12022761-12022783 CAGAGGAAGCCGCAATTCGAGGG - Intronic
902453979 1:16518492-16518514 CAGAGAAAGAAGCAAGGTGATGG + Intergenic
903063448 1:20685479-20685501 GGGGGGAAGCAGCAAGCAGAGGG - Intronic
903788201 1:25875264-25875286 CCGGGGAAGCAGCCAGCGGAGGG - Intergenic
903852563 1:26316899-26316921 TAGAGAAAGTAGCAAGCAGATGG - Intronic
903967448 1:27099613-27099635 CAGGGGAAGCTGCTAGGGGAAGG - Exonic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
906476626 1:46173637-46173659 CAGAGGCAGCAGCAGCCAGAGGG - Intronic
907108570 1:51906110-51906132 GAGTGGAAGCAGCCAGCTGAGGG - Intergenic
907184320 1:52598197-52598219 TAGAGGAAGCAGCAAGTACAAGG - Intergenic
907393059 1:54171219-54171241 CAGAGGAAGCAGCGAGTGTAAGG + Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908241695 1:62194220-62194242 CAGAGGAAACAGCCAGTGCAAGG + Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
910146386 1:84085521-84085543 CACAGGAAGCAGCAAGATGAGGG + Intronic
910157461 1:84235016-84235038 TAGAAGAAGCAGCAAGCAGTAGG - Intronic
910845564 1:91601807-91601829 CTGAGGAAGCAGCAACGGCAGGG - Intergenic
912179057 1:107195733-107195755 CAAAGGAATCAGCAAGTGCAAGG - Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914215907 1:145627999-145628021 CAGAGGAAGGAACAAGTTGAGGG + Intronic
914467850 1:147948384-147948406 CAGAGGAAGGAACAAGTTGAGGG + Intronic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915083816 1:153370776-153370798 CAGAGGGAGCAGCCACGGGAGGG + Intergenic
916951747 1:169787484-169787506 AAGAGGAAGCATCAAGGGTAAGG - Intronic
918724493 1:187901839-187901861 AAGAGGAAGCAGTAAATGGAGGG - Intergenic
919071185 1:192756947-192756969 CAAAGGAAGCAGGAAGAAGATGG - Intergenic
919275452 1:195409314-195409336 CAGAGGAGGCAGAAAGGGAAGGG + Intergenic
919866541 1:201787174-201787196 GAGAGGAAGCATCAGGTGGAGGG + Intronic
920883619 1:209903250-209903272 CAGAGGGAGCAAGAAGGGGAGGG + Intergenic
921850420 1:219927959-219927981 CAGCGGCAGCAGCTGGCGGAGGG - Exonic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
924438498 1:244067328-244067350 CAGTGGAGGCAACCAGCGGACGG + Intergenic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063481772 10:6382696-6382718 CAGAGGCTGGAGCAAGAGGAGGG - Intergenic
1066435423 10:35393006-35393028 CACAGGAGACAGCAAGGGGAGGG - Intronic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1068253216 10:54470573-54470595 CATAGGAAGCTGCATGGGGATGG - Intronic
1068894236 10:62181751-62181773 AAGAGGAAACAGCAAGTGCAAGG + Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072795787 10:98353508-98353530 CATAGGAAGGAGGGAGCGGATGG + Intergenic
1072923970 10:99600013-99600035 CAGAGGAAGCTCCCAGAGGAAGG - Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073340775 10:102742906-102742928 CAGAAGAAGCAGCAAGGAGATGG + Exonic
1073893330 10:108124708-108124730 CAGAGGAGGCAGCAACAGTATGG + Intergenic
1074158430 10:110817785-110817807 CAGAGGAAGCAGCATGCACAAGG + Intronic
1074439166 10:113459854-113459876 CAGAGCATGCAGCGAGGGGAAGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074848038 10:117416071-117416093 AAGAGGAAACAGCAAGGGTAAGG + Intergenic
1074854413 10:117462608-117462630 CAGAGGAAGAAGCAACCAGCAGG - Intergenic
1075063044 10:119270016-119270038 CAGAGGGAACAGCAATAGGAAGG - Intronic
1075406660 10:122200036-122200058 CAGAGCACACAGCAAGCTGAGGG + Intronic
1076684332 10:132190315-132190337 CAGAGGAGGCTGGGAGCGGACGG - Intronic
1076874870 10:133211051-133211073 AAGGGGAAGCACCAAGCAGAGGG + Intronic
1077262011 11:1627443-1627465 CAGAAGAAGCAACAAGGAGAAGG - Intergenic
1077609864 11:3637478-3637500 CATAGGGAGCAGGAAGCAGAGGG + Intergenic
1077843441 11:5999298-5999320 CAGGGGAAGCAGCAAGCTTGGGG + Intergenic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078329743 11:10409525-10409547 CAGAGACAGCAGGAAGCAGAGGG + Intronic
1078515551 11:12018963-12018985 CAGAGAAAGAAGCAAGCAGTGGG + Intergenic
1078889322 11:15539867-15539889 CAGAGGCAACATCAAGCGGGGGG - Intergenic
1078929141 11:15900036-15900058 CAGAGCAAGCTGCAAGCAGATGG + Intergenic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1081336428 11:41872645-41872667 GAGAGGAAGCAGGGAGCAGAGGG - Intergenic
1081702253 11:45159245-45159267 CCCAGGAGGCAGCAGGCGGAGGG - Intronic
1081963425 11:47154883-47154905 CAGTGGCACCAGCTAGCGGATGG - Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083190708 11:61050075-61050097 CAGAGGAAACTGGAAGGGGAAGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084460278 11:69293221-69293243 AGGAGGAAGGAGCCAGCGGAGGG - Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1085932555 11:81101933-81101955 CAGAGGAAGTAGCAGATGGAAGG - Intergenic
1086558656 11:88141778-88141800 CAGAGGAAACAGCACGTGAAAGG - Intronic
1088797141 11:113273689-113273711 CAGTGGAAGGAGCAAGCTCAGGG - Intronic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1091230682 11:133986158-133986180 AAGAGCAAGCTGCAAGCTGAGGG - Intergenic
1091239691 11:134044094-134044116 CAGAGGGAGCTGCATGGGGAAGG - Intergenic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1091671867 12:2457662-2457684 CAGGGGGCGCAGCACGCGGAAGG - Exonic
1091936591 12:4439827-4439849 GAGAGAGAGCAGCAAGGGGAAGG - Intronic
1095965637 12:47865158-47865180 CAGGCGAAGCATGAAGCGGAAGG - Exonic
1097959349 12:65517321-65517343 TAGAGGAAGCATCCAGTGGAAGG + Intergenic
1098176078 12:67792621-67792643 CAGTGGATGCAGCCCGCGGAGGG - Intergenic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1101180056 12:102206538-102206560 CAGAGAAAGCTGCAAAAGGAAGG - Intergenic
1102798911 12:115714528-115714550 CAGAGGAGGCAGGAAGAGAAAGG + Intergenic
1103221250 12:119247502-119247524 CAAAGAAGGCACCAAGCGGATGG - Intergenic
1103367644 12:120394790-120394812 CAGAGGAAGCCGGAAGCTGGAGG - Intergenic
1104436949 12:128764290-128764312 CAGAGAAAGCTCCAAGCAGAGGG + Intergenic
1104574822 12:129957459-129957481 CCCGGGAAGCAGCAGGCGGAAGG + Intergenic
1104901548 12:132191980-132192002 TACAGGAAGCAGCATGCGGGGGG - Intergenic
1104934578 12:132357724-132357746 CAGAGGCAGCAGGGAGCGGATGG - Intergenic
1105955909 13:25282464-25282486 AGGAGGAAGCAGCCAGAGGATGG + Intronic
1106565108 13:30877736-30877758 CAGAGAAAGCAACAAGGAGAAGG - Intergenic
1108774759 13:53751965-53751987 AAGAGGAAGCAGCAAGACAAAGG + Intergenic
1109332386 13:60945539-60945561 CAGAGGGAGCAGCTAGTGCAAGG + Intergenic
1111376054 13:87380137-87380159 CAGAGTAAGCTGCACGTGGAGGG - Intergenic
1112339064 13:98537610-98537632 CCCAGGAAGCAGCAAGCAGGTGG + Intronic
1112416426 13:99206882-99206904 GAGAGGGAGCAGGAAGCGGAAGG - Intronic
1113050465 13:106205889-106205911 GAGAGGAAGCTGCAAACAGAAGG + Intergenic
1113738852 13:112697139-112697161 CACAGGAAGCAGCCCACGGAAGG - Intronic
1114429019 14:22644674-22644696 CAGAGGAAGAAGCAGGTTGATGG - Intergenic
1115921492 14:38379244-38379266 CAGAGGAAACAGCAAGTGAATGG + Intergenic
1119198306 14:72733589-72733611 GAGAGGACGCAGCAGGCTGATGG - Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1120945105 14:89987526-89987548 CAGAGGAGGAAGCAAGCAGGTGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1122147051 14:99697710-99697732 CAGAGGAAGCAGCAAGGCACTGG + Intronic
1122180174 14:99949208-99949230 ACGAGGAAGCACCAAGGGGATGG + Intergenic
1122196539 14:100091574-100091596 CAAAGGATGCAGGAAGAGGATGG - Intronic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1124343350 15:28904147-28904169 CAGAGATAGCAGAAAGCGAAAGG + Intronic
1125766430 15:42139675-42139697 CAGAGCAAGAAGCCAGGGGAGGG - Exonic
1126064920 15:44819366-44819388 CAGAGACTGCAGCAAGAGGAGGG - Intergenic
1126094914 15:45081221-45081243 CAGAGACTGCAGCAAGAGGAGGG + Intergenic
1126475221 15:49058792-49058814 CAGTGGAAGCAGCAAGGCCAAGG - Intergenic
1126579835 15:50232644-50232666 CAGAGCAAGAAGCAAGGAGACGG + Intronic
1126744096 15:51807536-51807558 GAGTGGAAGCAGCAATCAGAAGG + Intronic
1127122051 15:55780297-55780319 AAGAGGAAGGAGGAAGCAGAAGG + Intergenic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129265653 15:74391906-74391928 CAGAGGCAGCAGTAGGCGGTGGG - Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130409594 15:83633660-83633682 CAGAGGAAACGGCAAGCAGGTGG - Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1133313592 16:4867737-4867759 CAGAGGATGCAGTGAGAGGAAGG + Intronic
1133546711 16:6814676-6814698 CACAGGGAGCAGCATGTGGAAGG + Intronic
1134771648 16:16814438-16814460 CAGAGAAAGCAGGAAACAGAAGG - Intergenic
1135134431 16:19877135-19877157 CAGAGGAAACAGCTATGGGATGG + Intronic
1135622560 16:23968397-23968419 AAGAGGAAGAAGCAAGCGGAGGG + Intronic
1136239624 16:28936252-28936274 CAGAGGAAACAGTAAGTGCAAGG - Intronic
1137322334 16:47397716-47397738 TAGAGGAAGCAGCAAAGGCAAGG + Intronic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1138065331 16:53935160-53935182 GAGAGGAATCAGGAAGCGTATGG + Intronic
1138609397 16:58110802-58110824 CAGAGGAAGAAGGAAGCGAGGGG - Intergenic
1138721502 16:59087457-59087479 CAGAGGGAGCAACAAGTAGAAGG + Intergenic
1139323550 16:66134477-66134499 CAGCGGAAGCAGGTATCGGAGGG - Intergenic
1139419711 16:66842993-66843015 CAGAGGACGCACCAGGTGGAGGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141759539 16:86018798-86018820 AAGAGGAAGCAGTAAGCGTTGGG + Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142863113 17:2775527-2775549 CAGGGGGAGCAGCAAGTGCAAGG + Intergenic
1143692498 17:8581146-8581168 CAGATGGAGCAGGAAGGGGAGGG + Intronic
1143864851 17:9916475-9916497 CCGAGGAAGCAGCTGGGGGAAGG + Exonic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144961543 17:19046967-19046989 CAGAGGAAGCAGGAAGCTGTCGG - Exonic
1144973617 17:19127557-19127579 CAGAGGAAGCAGGAAGCTGTCGG + Exonic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1146638949 17:34525943-34525965 CAGAGGGGGCAGGAAGCTGAGGG + Intergenic
1147122455 17:38343676-38343698 CAGAGGGGGCAGAGAGCGGATGG + Exonic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148846678 17:50533783-50533805 CAGAGGAGGGAGGAAGCTGAGGG - Intronic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1152388342 17:79988456-79988478 CAGAGGGGGCAGCAACCGGACGG + Intronic
1152885380 17:82846243-82846265 CAGAGGACGCAGCGCGTGGAGGG - Intronic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1153352047 18:4092190-4092212 CAAAGAAAGCAGAAAGCTGAGGG - Intronic
1153678333 18:7476186-7476208 CAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157644444 18:49252737-49252759 CAGAGGAAACAGCCAGTGGAGGG + Intronic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1157756909 18:50226682-50226704 CAGAGGAAAAAGCCAGCGCAAGG - Intergenic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1158273531 18:55742193-55742215 CAGAGGACACAGCCAGGGGAGGG - Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158707629 18:59807491-59807513 CAATGGAAGCAGCCAGAGGAAGG - Intergenic
1158965262 18:62616863-62616885 CAGAGTAAGCAGCAAGGGCTAGG + Intergenic
1160596681 18:79980308-79980330 GAGAGGATGCTGCAAGCTGAGGG - Intronic
1160904883 19:1447291-1447313 CAGAGGAGGCATCAAGGGGGCGG + Intronic
1162967118 19:14161282-14161304 CAGAGGCTGCAGCCAGGGGAGGG - Intronic
1163101680 19:15101161-15101183 CAGAGGAACCAGCAAAGGGGTGG - Intergenic
1163288072 19:16361720-16361742 CCAGGGAAGCTGCAAGCGGAAGG + Intronic
1164984031 19:32635120-32635142 TACAGGGAGCAGCAAGGGGATGG + Intronic
1165102593 19:33447645-33447667 CAGAGGGAGCTGCGAGAGGACGG + Intronic
1165454923 19:35904820-35904842 CAGAGGAAACAGCACACGCAGGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167246434 19:48375892-48375914 CAGAGGAAGCGGCACCTGGAAGG - Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
925681947 2:6431722-6431744 CACAGCAGGCAGCAAGAGGAGGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926155915 2:10454008-10454030 GACAGGGAGCAGCATGCGGAGGG + Intergenic
927427384 2:22996112-22996134 GAGAGGCAGAAGCAAGAGGAAGG + Intergenic
927725554 2:25419702-25419724 CAGAGGACGAAGCAAGCAGCAGG + Intronic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
928692496 2:33815279-33815301 CACCGGAAGGAGCAAGGGGAAGG + Intergenic
929701748 2:44168724-44168746 CCGAGGGAGCAGCACGGGGAGGG + Intronic
932055056 2:68434936-68434958 CAGAGGAAACTGCAAGTGCACGG + Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932399929 2:71473287-71473309 CAAAGGCAGCAGCAAGTGAAAGG - Intronic
932442148 2:71744214-71744236 CTGAGGAAGGAGCATGCAGAAGG - Intergenic
933158740 2:79001650-79001672 CAGAGGAGGAAGTAAGAGGAGGG + Intergenic
933677188 2:85067214-85067236 CAGAGGCAGAAGCAAGCTCAGGG - Intergenic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
935413978 2:102795867-102795889 CATAGCAAGCAGCAAGAGAAAGG + Intronic
935628027 2:105187117-105187139 GAGAGGAAACATCAAGCGTATGG + Intergenic
935708028 2:105873137-105873159 CAGCTGAAGCAGCTAGCTGATGG + Intronic
936666185 2:114598454-114598476 CAGAGGTAGCAGGAAGTAGAAGG + Intronic
937656653 2:124384753-124384775 CAGAGGAAGAACAAAGCGGAGGG - Intronic
938110249 2:128559610-128559632 CAGAGGAGGCAGCGAGTGCAAGG + Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938925607 2:136038803-136038825 CAGAGAAAGCAGAAAGGGAAGGG - Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
946313889 2:218897288-218897310 CCGAGGCAGCAGAAAGGGGAGGG + Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947955725 2:234189185-234189207 AAGAGGCAGCAGCAAGAGGATGG + Intergenic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1169333042 20:4731363-4731385 TAGAGGAAGCAGGAAGCAAAGGG + Exonic
1170000517 20:11608803-11608825 CAGAGTAAGCTGCACACGGAGGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1173743471 20:45419046-45419068 CTGAGGAAGCAGGAAACTGAGGG - Intronic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1173876148 20:46373222-46373244 CAGAGGGAGCAACAACCAGATGG + Intronic
1174050481 20:47764071-47764093 CAGAGGGAGCAGCAAGTTCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174544680 20:51316522-51316544 CAGAGGAAGGAGGGAGCTGAGGG + Intergenic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176050314 20:63115856-63115878 CAGAGGCAGCAGCCAGGGGCTGG + Intergenic
1176243307 20:64084911-64084933 CAGAGAAGGCAGCAAGCAGGGGG - Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1179238698 21:39569416-39569438 CAGAGGAAGTAGCCAGGGCAGGG - Intronic
1179536255 21:42054700-42054722 CAGAGGTGGCAGTAAGAGGATGG + Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1180216791 21:46328838-46328860 CAGAGGTTGCAGGAAGCAGAGGG - Intronic
1181034808 22:20164789-20164811 CAGAGGAAGCAGGCAGGGGTGGG + Intergenic
1181260174 22:21591756-21591778 CAGAGGAAGCAGCCTGGCGAAGG + Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1183313591 22:37124925-37124947 AAGAGGAAGCAGCTGGCGGCAGG - Intergenic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1184008690 22:41730409-41730431 CAGATGAAGTAGCAAGAGTAAGG + Intronic
1184148821 22:42627042-42627064 TGGAGGAAGCAGCCAGGGGAGGG + Intronic
1184316134 22:43690756-43690778 CAAAGGAAGCAACAAGCAGAAGG - Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184799087 22:46749170-46749192 CAGAGAAAGCAGCAGGCAGTCGG - Intergenic
1184897657 22:47421049-47421071 CAGGGGAAGCAGCCAGGGAATGG - Intergenic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
949944194 3:9177366-9177388 CAGAGGGAGCAGCAAGTTCAAGG + Intronic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
952277559 3:31892181-31892203 CAGAGGAAGGAGCACGTGTATGG + Intronic
953600589 3:44359962-44359984 CAGAGGCAGCAGCTAGGGCAAGG - Intronic
953723038 3:45372991-45373013 CAGAGCAAGCAGCAAGAAGTAGG + Intergenic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
954383028 3:50229660-50229682 CAGAGGCAGCAGCAAGTGCAAGG - Intronic
954456249 3:50601280-50601302 CAGAGGAGGCCGCAGGCGGGAGG - Intergenic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
954805397 3:53216960-53216982 CAGAGGAAGCACCAGGTGGGAGG - Intergenic
954924498 3:54220609-54220631 CAGAGGAAGCAGCAGGTGTGGGG - Intronic
955410145 3:58650164-58650186 CAGAGGAAGCAGAAATCCTAGGG + Intronic
955796220 3:62639892-62639914 AAGAGGAAACAGCAAGTGCAAGG - Intronic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
958560132 3:95737960-95737982 CAGAAGAAGAAGCAGGCAGAGGG - Intergenic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961386933 3:126528055-126528077 GAGAGGAAACTGCAAGCAGAAGG + Intronic
961658315 3:128455284-128455306 CAGAGGCAGCAGGAAGCAGGTGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961826666 3:129602771-129602793 CACAGTAAGCACCAAGCAGATGG - Intronic
962314520 3:134350880-134350902 CAGGGGCAGCAGCAAGGGAAGGG - Intergenic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
964633959 3:158841205-158841227 CTGAGAAAGCAGAAAGCAGATGG + Intergenic
965359669 3:167723213-167723235 CAAATGAAGAAGCATGCGGAAGG - Intronic
966373091 3:179268670-179268692 CAGAGGAAGGAATAAGCTGAGGG - Intergenic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
967096560 3:186182048-186182070 CTGAGGAAGCACCAAGGGCATGG - Intronic
967135657 3:186510643-186510665 CAGTGGAAGCAGCCACAGGATGG - Intergenic
967198262 3:187048396-187048418 CAGAGGATGCAGCAAGTGTCAGG - Intronic
967711772 3:192716632-192716654 CAGAGGAAGTAGTAAGCCTAAGG + Intronic
969293147 4:6253242-6253264 CAGAGGGAACAGCAAGTGTAAGG + Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
970006611 4:11416956-11416978 CAGAGGAAACAGTATGCGTAGGG + Intronic
971341565 4:25774182-25774204 CAGAGGAAAAAGCCAGCGCAAGG + Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976114496 4:81712512-81712534 CAGAGGAAAGAGCAAGCTCAAGG + Intronic
977199357 4:94097847-94097869 CACTGGAAGCAGCAAGCGGTGGG - Intergenic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
979429596 4:120612669-120612691 GAGAGGCTGCAGCAAGTGGAAGG - Intergenic
979462027 4:120994768-120994790 CAGAGGTAGGACCAAGTGGAAGG - Intergenic
982096813 4:151930867-151930889 CAGAGGAAGGGGGAAGCAGAGGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983571056 4:169208391-169208413 CAAAGGAAGCAGCAATGGGTAGG + Intronic
984149888 4:176114873-176114895 CCAAGGAAGCAGCAAGCAGAAGG + Intronic
984549898 4:181147552-181147574 CAGAGCAAGCACCTTGCGGAAGG + Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
985273838 4:188219021-188219043 CAGAAGAAGGTGCAAGCGGCTGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
991622288 5:68557277-68557299 CAAAGCAAGCAGCAACCAGAGGG + Intergenic
992222117 5:74583387-74583409 CATAGGATGCAGGAAGAGGAAGG - Intergenic
993714454 5:91261634-91261656 CTGAGGCAGCAGAAAGCTGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994743459 5:103649473-103649495 TAGAGGGAGCAGCAAGTGGAAGG + Intergenic
995139995 5:108725170-108725192 AAGAGGAAGCATCAAGGGTAAGG + Intergenic
995337912 5:111023668-111023690 CAGAGGAAACAGCACACGGGTGG + Intergenic
995381416 5:111538426-111538448 CAAAGGAAGAAGCTAGAGGAGGG + Intergenic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
995710426 5:115029901-115029923 CAGAGGTAGCTGGAAGCTGAAGG - Intergenic
996493599 5:124128099-124128121 CAGAGGAAGACGCAAGCTAATGG + Intergenic
997212624 5:132086429-132086451 CAAAGGAAGCTGCAAGAGGGAGG + Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997628253 5:135346245-135346267 CAGATGAAGCAGCAATTTGAGGG - Intronic
999378789 5:151105460-151105482 CAGAGGAGGAAGCATGGGGAAGG - Intronic
999430683 5:151522742-151522764 CAGAGGGAGCAGCAAGTGTAAGG + Intronic
1000607721 5:163342452-163342474 CAGAGGAAGAACCAGGCAGATGG - Intergenic
1002079358 5:176728270-176728292 CAGAGGACCCAGCATGCAGAAGG - Intergenic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1006878361 6:37317831-37317853 CAGAGGAAACAGCCAGTGCAGGG + Intronic
1007408133 6:41646428-41646450 CACAGGCAGCAGAAAGGGGAAGG + Intronic
1007749745 6:44064612-44064634 CAGAGAAGGCAGGAAGCAGAGGG + Intergenic
1008458377 6:51738795-51738817 CAGAGGGAGCAGCCAGGGCAGGG - Intronic
1008760415 6:54846744-54846766 CCCAGGAAGCAGCAAGCGCCTGG - Intergenic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1015551938 6:134420679-134420701 CAGAGGGAAGAGCAAGCTGATGG - Intergenic
1016221859 6:141682819-141682841 CCAAGGGAGGAGCAAGCGGAGGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018736440 6:166690092-166690114 CAGGGGAAGGACCAAGCTGAGGG + Intronic
1019527688 7:1488046-1488068 CAGAGGCAGCAGCAGCCGTAGGG - Intronic
1019640891 7:2103115-2103137 CAGAGGCAGCAGCAAGCGCAGGG - Intronic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1021210244 7:17841906-17841928 CAGAGGAATCAGCAAATGTAAGG + Intronic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027190066 7:75991345-75991367 GAGAGGTAGCAGCAGGTGGACGG - Intronic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1029559322 7:101291991-101292013 CAGAGGAAGCAGGTAAGGGAGGG + Intergenic
1029910192 7:104137626-104137648 CAGAAGAACAAGCAAGCGGCTGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031486197 7:122328959-122328981 TAGAGCAAGCAACAAGCTGAAGG + Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1035781073 8:2228910-2228932 CAGTGGACGCAGCAAGGGGTCGG - Intergenic
1035928592 8:3756898-3756920 CAGAGGTTGAGGCAAGCGGATGG - Intronic
1036616080 8:10388836-10388858 CAGGGGAAGCAGCAAGCTAATGG - Intronic
1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG + Exonic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1038697523 8:29819415-29819437 CAGAGGGGGCAGCAGGCTGATGG - Intergenic
1038806730 8:30800879-30800901 GAGAGGAAGAAACAACCGGATGG + Intronic
1038843708 8:31209836-31209858 CAGAGGGAGCTGCCAGCTGAGGG - Intergenic
1039981168 8:42410981-42411003 CCGAGGAAGCGGCATGCGGAAGG - Intergenic
1040058723 8:43086080-43086102 CACAGGCAGCAGCAACGGGACGG - Intergenic
1041051746 8:53941037-53941059 CAGAGAAAGGAGGGAGCGGAAGG - Intronic
1041223357 8:55673734-55673756 CAAAGAAAGCACCAAGGGGATGG + Intergenic
1042848489 8:73191975-73191997 CACAGGATGGAGGAAGCGGAAGG - Intergenic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1045490203 8:102662460-102662482 CTGAGGAAGAAGCAGGCTGAAGG + Intergenic
1046506254 8:115141495-115141517 CAGAGGAAGCAATAACTGGAAGG + Intergenic
1047179012 8:122569362-122569384 CATAGGAGACAGCAAGCAGACGG + Intergenic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1048030409 8:130626261-130626283 CAGAGGAAACAGCAAAGTGAAGG - Intergenic
1048538811 8:135323631-135323653 GAGTGGAAGCAGCAAGCAGTGGG + Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1050076915 9:1875135-1875157 CAGAGGAAGAAGCTAACAGAAGG - Intergenic
1051808032 9:21018006-21018028 CACAGAAAGCAGCAACAGGATGG + Intronic
1052424266 9:28284150-28284172 CAGAGGAAGCAGACATTGGAAGG - Intronic
1052986583 9:34492311-34492333 CAGAGGAAGCAGCAAGGATCTGG - Intronic
1053429128 9:38030395-38030417 TAGAGAAAGCAGCAAGTGGGAGG - Intronic
1053472233 9:38355123-38355145 GAGAGGAAGAAGGAAGGGGAGGG + Intergenic
1055217248 9:73880673-73880695 TTGAGGAAACAGCAAGCAGAAGG - Intergenic
1055222875 9:73959194-73959216 CTGAGGAAGCAGCCTGGGGATGG + Intergenic
1055324324 9:75112981-75113003 GAAAGGAAACACCAAGCGGAAGG - Intronic
1055360212 9:75481577-75481599 CACAGGAAGCAGCCAGAGGGAGG + Intergenic
1055707973 9:79028567-79028589 CAGAGGGAGGAACAAGTGGAAGG - Intergenic
1056132759 9:83601931-83601953 CAGAGAGAGCAGCAAGTGCAAGG + Intergenic
1057596598 9:96419399-96419421 CAGAGGAAGGACCGGGCGGAGGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1058717346 9:107734875-107734897 CAGAGGCAGCAGCAACTGGTAGG + Intergenic
1059163036 9:112053090-112053112 CAGAGGAAGCTGCACGGTGAGGG + Intronic
1059441631 9:114310736-114310758 AAGAGGAAGAGGCAAGGGGAGGG + Exonic
1059734820 9:117090654-117090676 CAGAGTAAGCACCCAGTGGAAGG - Intronic
1060175016 9:121491348-121491370 CAGAGAAAGGAGCAAGCCTAGGG - Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061234341 9:129333923-129333945 CAGAGGAGGCAGCAAGTGTGAGG - Intergenic
1061498256 9:130987931-130987953 GAGCGGAGGCAGGAAGCGGAGGG + Intergenic
1061868757 9:133509038-133509060 CAGAAGAGGCAGGAAGCAGATGG - Intergenic
1062649628 9:137568936-137568958 CACAGGAGGCAGCAAGCACAAGG + Intronic
1186168248 X:6849735-6849757 CATAGAAAGGAGGAAGCGGATGG + Intergenic
1186496255 X:10014944-10014966 GAGGGGGAGGAGCAAGCGGAGGG + Intergenic
1186513709 X:10150277-10150299 GTGAGGAGGCAGCAAGCTGAGGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1186806669 X:13146662-13146684 CAGGGGAAGGAGCAAGCCAAGGG - Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189604747 X:42664804-42664826 CAAAGGAAGCAGGCAGCAGAAGG + Intergenic
1189610305 X:42726151-42726173 CAGAGGAAGAAACAAGCAAAGGG + Intergenic
1189615685 X:42780623-42780645 AAGAGGAAGAAGCAATGGGAAGG - Intergenic
1192214175 X:69146703-69146725 CAAGGGAAGCAGGAAGCGGGAGG + Intergenic
1195129437 X:101839200-101839222 CTCAGGAGGCAGGAAGCGGAAGG + Intronic
1195176801 X:102320629-102320651 CTCAGGAGGCAGGAAGCGGAAGG - Intronic
1195182063 X:102366464-102366486 CTCAGGAGGCAGGAAGCGGAAGG + Intronic
1196023140 X:111011167-111011189 GAGAGGCTGCAGCAAGGGGAAGG + Intronic
1196670659 X:118363548-118363570 CTAAGGGAGCAGCAAGCAGATGG + Intronic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1199086121 X:143633180-143633202 CAGAGGAAGCCACAAGCAGCTGG + Intronic
1199849715 X:151716750-151716772 CAGAGGAAACAGCAAATGCAAGG - Intronic
1200386326 X:155894567-155894589 GAGAGGAAGCAGCAAGCATAAGG - Intronic
1200531695 Y:4347687-4347709 CAGATGCAGCAGCAGGCTGAAGG - Intergenic