ID: 1023725436

View in Genome Browser
Species Human (GRCh38)
Location 7:43138420-43138442
Sequence GTAAATTAATTAGGAACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023725431_1023725436 18 Left 1023725431 7:43138379-43138401 CCATTTTAGTTCCTAAAGCACAG 0: 1
1: 0
2: 2
3: 31
4: 226
Right 1023725436 7:43138420-43138442 GTAAATTAATTAGGAACCACCGG No data
1023725432_1023725436 7 Left 1023725432 7:43138390-43138412 CCTAAAGCACAGATTGCTCCAGC 0: 1
1: 0
2: 0
3: 21
4: 166
Right 1023725436 7:43138420-43138442 GTAAATTAATTAGGAACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023725436 Original CRISPR GTAAATTAATTAGGAACCAC CGG Intronic
No off target data available for this crispr