ID: 1023727231

View in Genome Browser
Species Human (GRCh38)
Location 7:43156286-43156308
Sequence GGACAGAGCAGGCCCCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023727231 Original CRISPR GGACAGAGCAGGCCCCCAGT AGG Intronic
900205670 1:1431060-1431082 GGACAGAAGAGGCCCTCCGTTGG + Intergenic
900205687 1:1431104-1431126 GGACAGAAGAGGCCCCACGTTGG + Intergenic
900724982 1:4210241-4210263 TCACAGGGCAGGCCCCCAGGTGG - Intergenic
901005984 1:6171718-6171740 GGACAGAGCAGAGGCCCAGAGGG + Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
901659334 1:10788848-10788870 GCACAGAGGAGCCCACCAGTGGG + Intronic
901703452 1:11057667-11057689 GGTCAGGGCAGGCCTCCAGGAGG - Intronic
901850098 1:12009562-12009584 GGAGAGAGAAGGGACCCAGTTGG - Intronic
902290363 1:15431190-15431212 AGACAGATCAGGCCCCCACTGGG + Intergenic
903631447 1:24776079-24776101 GCACAGAGCAGGCTCCAAGTAGG - Intronic
904263783 1:29306194-29306216 AGACAGAGCAGGCAGCCAGGAGG + Intronic
904812170 1:33170583-33170605 GGGGAGAGAAGGCCCCCAGCAGG + Intronic
904824170 1:33264003-33264025 AGACAGAGCAGGCCCCAAGCAGG - Intronic
905900898 1:41581463-41581485 GGGCAGGACAGGCCCCCATTGGG - Exonic
906193018 1:43910852-43910874 GGCCAGAGGAGGACCACAGTGGG - Intronic
906746626 1:48226432-48226454 ACACAGAGCAGGCACCCAGTGGG + Intronic
908228431 1:62079792-62079814 GAACAGAACAGGACCTCAGTAGG + Intronic
910303603 1:85736161-85736183 GCACAGAGCAGGCCCTCTGGTGG + Intronic
912240365 1:107901141-107901163 GGACATAGCAGCTCCCCAGCTGG - Intronic
913062974 1:115224838-115224860 AGACAGGGCAGGCACCCATTGGG - Intergenic
913333687 1:117687731-117687753 GGTCAGAGCAGGGCCGCTGTAGG + Intergenic
915200253 1:154221457-154221479 GATCAGAGGAGGCCCGCAGTGGG - Intronic
917167155 1:172125011-172125033 GGACAGTCCAGTCACCCAGTTGG - Intronic
917660303 1:177171300-177171322 GGACAGGGGACTCCCCCAGTTGG + Intergenic
919249122 1:195030311-195030333 GGAGAGAGAAGGCCCACACTGGG + Intergenic
919883621 1:201917035-201917057 AGACAGAGCAGGCCCTGAGATGG - Intronic
920977523 1:210800049-210800071 GGACAAAGCCTGGCCCCAGTAGG + Intronic
922531995 1:226351769-226351791 GGATGGAGAAGGCCCCCAGCTGG + Intergenic
1064221097 10:13440598-13440620 GGACAGAGCACGCCCGCGGGAGG + Intronic
1065746141 10:28844310-28844332 GGCCAGAGCAGTCCTCCAGATGG + Intergenic
1067576540 10:47412333-47412355 GGACGCAGAAGGCCCCCACTGGG - Intergenic
1069706165 10:70460135-70460157 GGACTGAGCAGGGGCCCAGACGG - Intergenic
1069757625 10:70782783-70782805 GGTCCCAGCAGGCCTCCAGTGGG - Intronic
1070457369 10:76630750-76630772 GGACAGAGGAGCTCCCCACTTGG + Intergenic
1070654489 10:78262064-78262086 GGGCAGAGCACGCGCCCACTCGG + Intergenic
1070668059 10:78359274-78359296 GGAGAAAGCAGGCAGCCAGTGGG + Intergenic
1072566163 10:96618409-96618431 GGACAGGGCAGGTTTCCAGTGGG - Intronic
1072758724 10:98038524-98038546 GGAGAGAGCAGGCCCCAGGGAGG + Intergenic
1073338186 10:102726401-102726423 GCACAGAGCTGGCCACCAGCAGG + Intronic
1075044175 10:119133129-119133151 GGGCAGAGCAGGTGCCCACTGGG - Intronic
1075054211 10:119206345-119206367 GGACAGAGAAGGCCCAGAGTCGG + Intergenic
1075829292 10:125391838-125391860 GGACAGAGCAGGCACAAAGCTGG - Intergenic
1076138846 10:128064022-128064044 GGACACAGCAGGCCCTGAGCAGG - Intronic
1076347916 10:129793356-129793378 GGGCAAAGCCGGCACCCAGTAGG + Intergenic
1077098763 11:811764-811786 GGAGTGAGCAGGGCTCCAGTGGG + Intronic
1077220885 11:1415675-1415697 GGGCAGAGCAGGCCCCGGGCAGG - Intronic
1077374295 11:2198339-2198361 GGACAGAGGAGGGGGCCAGTGGG + Intergenic
1080871033 11:36237182-36237204 CAAAAGAGCAGGCCCCCAGGTGG - Intergenic
1082224290 11:49684219-49684241 GGACATAATAGGCCCACAGTAGG + Intergenic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083726471 11:64631061-64631083 GTACCAAGCAGGCCCCCAGGGGG + Intronic
1085302042 11:75464460-75464482 GCACGGAGCAGGCCCTTAGTGGG - Intronic
1085389189 11:76173661-76173683 AGACAGAGCAGGCCCGGAGGGGG + Intergenic
1085971420 11:81595759-81595781 GGACAGAGCAGCTCTCCATTGGG + Intergenic
1086440077 11:86820435-86820457 GGACAGGGCAGGTTTCCAGTGGG + Intronic
1087833001 11:102840158-102840180 GGACAAAGCAGGATCACAGTTGG + Exonic
1088227870 11:107641589-107641611 AGACAGGGCAGGCTTCCAGTGGG + Intronic
1090201543 11:124861381-124861403 GCAAAGAGCAGGCACCCAGCTGG - Intergenic
1090968677 11:131620724-131620746 GGACAGTGCAGGCCTGCAGGTGG - Intronic
1091556453 12:1577178-1577200 ACACAGGGCAGGCCCCCAGAGGG - Intronic
1094123163 12:26995357-26995379 GGACAGACCAGGACTCCAGGTGG - Exonic
1096717479 12:53499912-53499934 GGAGAGAGCAGCCCCTCAGTTGG + Intronic
1097003958 12:55901735-55901757 GGACAGAGCTGGGCCGCAGGAGG + Exonic
1097189170 12:57211380-57211402 GGACAGGGCAGGGGCCCAGCTGG - Intronic
1099284610 12:80702393-80702415 GGACTGAGCAGGTACCCAGGAGG - Intergenic
1099874083 12:88382954-88382976 GGACAGAATAGACCCCAAGTAGG - Intergenic
1100368321 12:93942176-93942198 GGAAAGAGCAGTCTCCCATTTGG + Intergenic
1101417930 12:104524719-104524741 GGACAGAACTGGCACCCAGTAGG - Intronic
1101726948 12:107395709-107395731 GACCAGAGCTGGCCCCCACTGGG - Intronic
1104740217 12:131166422-131166444 GGTGAGAGCATGCCCCCAGGAGG - Intergenic
1105779548 13:23695084-23695106 GGAAAGGGCAGGCCCCTAGGAGG + Intergenic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1106379569 13:29223338-29223360 GCAAAGAGGAGGCCCACAGTGGG - Intronic
1108074070 13:46660555-46660577 GGACAGAGCAGGAACTCAGCAGG + Intronic
1108854392 13:54775302-54775324 GCAGAGAGGAGGCCCACAGTAGG + Intergenic
1109082264 13:57919429-57919451 CCACAGAGCAGGGCACCAGTAGG - Intergenic
1113578804 13:111413901-111413923 GGCCAGAGCAGGCCTTCAGAGGG + Intergenic
1113637094 13:111927068-111927090 GAGCAGAGCAGGGTCCCAGTAGG + Intergenic
1114410810 14:22498629-22498651 GGACAAAGCAGGCCCCCACATGG + Intergenic
1120728905 14:87979829-87979851 GGACAGAGCAGAAGCCAAGTTGG - Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121801927 14:96781694-96781716 GGTCAGAGCAGGCTCCAATTTGG + Intergenic
1122199798 14:100115485-100115507 GGACTGACCAGGGCCACAGTGGG - Intronic
1122272891 14:100576254-100576276 GGACAGAGCAGGCCACCTGAGGG + Intronic
1122534918 14:102455378-102455400 GGACAGAGCTGGGCCCCAGGCGG + Intronic
1122822690 14:104355146-104355168 CGGCACAGCAGGCCCCAAGTTGG + Intergenic
1122854476 14:104553539-104553561 GGTCAGAGCAGCACCCCCGTGGG + Intronic
1125689601 15:41585475-41585497 GGACAGAGCCGGCGCCCTGCAGG + Intergenic
1127289508 15:57557566-57557588 GGACAGAGCCTGCTCACAGTGGG - Intergenic
1129345993 15:74919433-74919455 GGAAAGCGCTGGCCCACAGTGGG + Intergenic
1131152279 15:90054501-90054523 GGATAGAGCAGGCCCCAGCTGGG - Intronic
1132603246 16:783144-783166 CTGCAGAGCAGGGCCCCAGTGGG - Intronic
1132796837 16:1728679-1728701 GGGCACAGCAGCCCCCCAGACGG + Intronic
1132796857 16:1728795-1728817 GCACACAGCAGCCCCCCAGACGG + Intronic
1132854484 16:2038705-2038727 GGAGAGCCCAGGCCCCCAGCAGG - Exonic
1133328613 16:4957758-4957780 GGACAGGGCTGACCCCCAGCAGG + Intronic
1134047673 16:11112996-11113018 GTACAGAGCCTGGCCCCAGTAGG + Intronic
1134831962 16:17331055-17331077 GGGCAGAGCAGGCAGCCACTGGG + Intronic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1135969083 16:27059185-27059207 GGGAAGAGTAGGGCCCCAGTGGG + Intergenic
1137607555 16:49796678-49796700 GGTCAGAGGAGGCCTCTAGTAGG + Intronic
1138536656 16:57663857-57663879 GGAGAGACCAGGCCTCCAGCTGG - Exonic
1138542612 16:57697663-57697685 AGACAAAGCAGGCCTCCGGTTGG - Intronic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1142121710 16:88389805-88389827 CGACAGCGCAGTCCCCCAGGAGG + Intergenic
1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG + Intronic
1142474106 17:179864-179886 GGTTAGAGCAGGGCCCCTGTAGG - Intronic
1143376094 17:6468524-6468546 GGCCAGAGCAGTCTCCCAGCTGG + Intronic
1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG + Intergenic
1144585126 17:16483083-16483105 GGCCAGAGCAGCCCCACAGTAGG + Intronic
1145755465 17:27386804-27386826 CGACAGAGGATGCCCTCAGTGGG - Intergenic
1145965179 17:28911853-28911875 TGAGAGAGCAGGTCCACAGTAGG + Intronic
1146375012 17:32287991-32288013 GGATAGAGCTGGTCCCCAGGTGG + Intronic
1147317053 17:39626086-39626108 GGACAGGGCCGGCCCAGAGTTGG - Intergenic
1148061948 17:44842739-44842761 GGACAGAGGATGCTCCTAGTTGG - Intergenic
1148623721 17:49053537-49053559 GGACAGAGCAGTCCCACAACAGG - Exonic
1149307465 17:55363029-55363051 GAACATAGAAGGCTCCCAGTGGG + Intergenic
1150003928 17:61457923-61457945 GGGCAAAGCAGCCCCCCAGGGGG - Intronic
1150122954 17:62618583-62618605 GGACATAGATGTCCCCCAGTGGG + Intergenic
1151625322 17:75272218-75272240 GGCCAGCGCCGGCTCCCAGTGGG + Intergenic
1152523372 17:80873271-80873293 AGACAGAGCAGCTCTCCAGTGGG + Intronic
1154336849 18:13472566-13472588 GGACAGAGGAGGCCGCCAGGTGG - Intronic
1156164056 18:34396741-34396763 TGACATAGTAGGCTCCCAGTTGG + Intergenic
1157271787 18:46281871-46281893 GGACAGTGCTTGCCCCCAGGAGG + Intergenic
1157498283 18:48171689-48171711 GCCCAGAGCAGGCACACAGTAGG + Intronic
1157600506 18:48890257-48890279 AGACACAGCAGGGCCCCAGCAGG - Intergenic
1159553015 18:69916692-69916714 GGACAGTTCATGCCCCTAGTAGG - Intronic
1160018543 18:75163046-75163068 CAGCTGAGCAGGCCCCCAGTGGG - Intergenic
1160683741 19:423980-424002 GTACACAGCAGGCGCCCACTAGG + Intronic
1160980810 19:1815787-1815809 GGACAGAGCCCGCCCCCACCCGG - Exonic
1161075339 19:2282476-2282498 GGGCAGAGCTGGCCCACCGTAGG + Intronic
1161560603 19:4970447-4970469 AGACAGTGCAGGCACCCGGTGGG - Intronic
1162776892 19:12985253-12985275 TCACAGAGCAGGCAGCCAGTAGG - Intergenic
1162919173 19:13890093-13890115 AGACAGAGGAGCCCCCCAGGAGG - Exonic
1163756224 19:19107865-19107887 GGACAGAGCAGCCCAGCAGGTGG - Intronic
1164685102 19:30161364-30161386 GGAGAGAGCAGCCCCCCTGAAGG + Intergenic
1165141730 19:33703940-33703962 GCACAGCGCAGGCTCCTAGTGGG + Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1167056094 19:47112407-47112429 CGACAGGTCAGGCCCCCGGTTGG - Exonic
925031079 2:650183-650205 GGACAGAGCTGGTCCCCATCAGG - Intergenic
927810547 2:26178199-26178221 AGCTTGAGCAGGCCCCCAGTGGG - Intronic
928131327 2:28653366-28653388 TGACAGAGCAGGACTCCATTTGG + Intergenic
929873116 2:45774590-45774612 GTACAGAGCAGGCAGCCTGTGGG + Intronic
932490409 2:72116359-72116381 GGACAGAGCAGGCCCCTCCTTGG - Intergenic
933649613 2:84840040-84840062 GGAGAGAGCATGCACCCAGGGGG - Intronic
933767207 2:85718457-85718479 GGACAGGGCAGGCAGCTAGTAGG - Intergenic
934561558 2:95316133-95316155 GGCCATGGCAGGCCCCCAGAGGG - Intronic
934781705 2:96973375-96973397 GCACAGACCTGGCCCACAGTAGG + Intronic
935205068 2:100890227-100890249 GGACACAGCCGGCCCACTGTAGG - Intronic
935755950 2:106276232-106276254 GCACAGAGTAGGCACACAGTAGG + Intergenic
936236633 2:110747892-110747914 AGAGAGAGGAGGCCCCCAGGAGG - Intronic
937343226 2:121105097-121105119 GGCCTGAGGAGGCCCACAGTGGG + Intergenic
937435172 2:121874091-121874113 GGACAAAGCAGCCGCCCTGTGGG - Intergenic
943671344 2:190665030-190665052 GGACAGAGTTTGCCACCAGTAGG - Intronic
944247917 2:197551327-197551349 GGACAGGGCAGGTTTCCAGTGGG - Exonic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
946870817 2:224083211-224083233 GGACAGAAGAGGCCACAAGTGGG + Intergenic
947897738 2:233691381-233691403 GGACAGGGCTGGCCCCCATGGGG - Intronic
948764574 2:240212833-240212855 GAACAAAGCAAGCCCTCAGTGGG + Intergenic
1171563419 20:26152074-26152096 AGACAGAGGAGGCTGCCAGTAGG + Intergenic
1172223204 20:33287638-33287660 GGCCAGAGCTGGTCCACAGTTGG + Intronic
1172855701 20:38000587-38000609 GCACATAGTAGGCGCCCAGTAGG - Intronic
1174202911 20:48819667-48819689 GAACAGAGCAAGGCCTCAGTGGG + Intronic
1174528601 20:51193253-51193275 CTACAGAGCTGGCACCCAGTGGG - Intergenic
1175807436 20:61837752-61837774 GAACAGAGCACCCCCCCCGTGGG + Intronic
1175813201 20:61869888-61869910 GGGGAGAGCTGGGCCCCAGTGGG + Intronic
1175944735 20:62553440-62553462 GGCCACAGCAGACACCCAGTGGG - Intronic
1176103998 20:63377125-63377147 GGACAGAGGGAGCCCCCATTTGG + Intronic
1176224041 20:63984705-63984727 AGACAGAGGAGACCCCCAATTGG - Intronic
1178835901 21:36097315-36097337 GGAAAGAGCAGGCAGGCAGTAGG - Intergenic
1179719623 21:43307743-43307765 GGACAGAGCAGCCATCCTGTGGG - Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1180176609 21:46093569-46093591 GCACAGAGCAGGCCCTGACTGGG - Intergenic
1180953830 22:19732544-19732566 GGGCAGAGAAGACCCCCAGGAGG - Intergenic
1181049952 22:20233746-20233768 GGACACAGCAGTTCCCCAGAGGG - Intergenic
1181145127 22:20840360-20840382 AGACAGAGAAGGTCCCCAGAGGG + Intronic
1181777626 22:25170911-25170933 GGACAGAGCAGTGCCAGAGTGGG + Exonic
1182096761 22:27630864-27630886 GGCCTGAGCAGGCCTCCAGGTGG - Intergenic
1182115674 22:27754977-27754999 GCACACACCAGGCCCTCAGTTGG + Intronic
1182476431 22:30579073-30579095 GGCCAGAGCAGGCACCAAGCAGG + Intronic
1182897883 22:33873799-33873821 GGGCAGGGCAGGACCCAAGTGGG - Intronic
1183498338 22:38163210-38163232 GGACAGAGGAGGGGCCCTGTGGG - Intronic
1183615623 22:38943490-38943512 GGACAGGGCAGGGACCCAGAGGG - Intergenic
1183717242 22:39540610-39540632 GGACTGAACTGGCCCCCTGTTGG - Intergenic
1184331063 22:43828260-43828282 GGCCATAGGAGGCCCCCTGTTGG - Intronic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
950267831 3:11588409-11588431 TGAGTGTGCAGGCCCCCAGTTGG + Intronic
950466827 3:13160796-13160818 GCACAGAACAGGCACCCAGGGGG - Intergenic
952214489 3:31263687-31263709 GGAAAGAACAAACCCCCAGTGGG + Intergenic
953356843 3:42263505-42263527 GGGCAGAGGAGGCGCCCCGTAGG - Exonic
954003691 3:47577069-47577091 GGACAGGCCAGCCCACCAGTCGG - Exonic
954451807 3:50575748-50575770 GGGCAGAGAAGCCCCCCAGAGGG - Intronic
954612796 3:51955212-51955234 GGACAGAGCAGGCACAGACTTGG - Intergenic
954747205 3:52794058-52794080 TGACAAAGCAGGCCCTCAGGGGG + Intergenic
956347235 3:68293842-68293864 AGACGGAGCAGTCCCTCAGTGGG - Intronic
956769265 3:72510651-72510673 GGACAGTGCTGGCACCCAGTAGG + Intergenic
958927054 3:100170468-100170490 GGAAAGTGCAGGCCCCCAGTTGG - Intronic
958993398 3:100873717-100873739 AGACAGATAAGGCCCCCAGTAGG + Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
962393212 3:134991672-134991694 ACAAAGAGCAGGCCCTCAGTAGG - Intronic
967326040 3:188240774-188240796 GGACAGAGCAGCCCTGCATTTGG - Intronic
968190210 3:196661629-196661651 TGACAGTGCAGGCCACCAGCAGG - Exonic
968452272 4:681252-681274 GGACAGAACAGGCCCCCGGGGGG + Intronic
968731020 4:2269253-2269275 AGGCAGGGCAGGCCCCAAGTCGG + Intergenic
968901739 4:3435312-3435334 GGACAGAGCAGGAGCCAGGTGGG - Intronic
968969266 4:3785001-3785023 TGACAGTGCAGGACCCAAGTTGG - Intergenic
968985596 4:3872770-3872792 GGACAGGGCGGGCACGCAGTAGG - Intergenic
969690890 4:8703547-8703569 GGACTGGCCAGGCCCCCAGGAGG + Intergenic
969943008 4:10753714-10753736 GGACAGAGCAGGGACAGAGTTGG - Intergenic
981540671 4:145843526-145843548 GGTAAGAGGAGGCCCCAAGTTGG - Intronic
985589342 5:756618-756640 GGACAGAGCAGGGCCACAGGAGG + Intronic
985604071 5:849338-849360 GGACAGAGCAGGGCCACAGGAGG + Intronic
985967581 5:3349237-3349259 GGACAGAGCAGGCTTTCAGGAGG - Intergenic
986025400 5:3845843-3845865 TGAGAGAGCAGGCCCCAGGTGGG - Intergenic
988593279 5:32567763-32567785 GGACACAGGAGGCACCCAGGAGG - Intronic
995433419 5:112108171-112108193 GGACACAGCCAGCACCCAGTAGG + Intergenic
998130104 5:139647541-139647563 TGCCAGAGTAGGCGCCCAGTGGG - Intronic
998405321 5:141870932-141870954 GGCCAGAGCCTGCCCTCAGTGGG - Intronic
998463463 5:142325544-142325566 AGCAAGAGAAGGCCCCCAGTAGG - Intronic
998516108 5:142755698-142755720 GGACAAAGGAGGCTCTCAGTGGG - Intergenic
999767540 5:154752999-154753021 GGGCAGAGCAGGCCCAGGGTAGG + Intronic
1001271338 5:170314459-170314481 GCATAGAGCAGGTACCCAGTGGG + Intergenic
1002062125 5:176631364-176631386 GCACACAGTAGGCCCTCAGTTGG + Intronic
1005843482 6:29759841-29759863 GGACAGAGCATGGCCACTGTGGG - Intergenic
1006348022 6:33498639-33498661 GGTCAGAGGAGACCCACAGTGGG - Intergenic
1006455058 6:34126854-34126876 AGACAGAGCTGGCCCCCGCTAGG - Intronic
1006506129 6:34489935-34489957 GGAGAGACCAGGTCCCCAGAAGG - Intronic
1007913181 6:45536233-45536255 GGTCAGCCCAGGCCTCCAGTGGG + Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1013693170 6:112668572-112668594 GCACAGAGGAGGCCCACAGTGGG - Intergenic
1018845371 6:167551911-167551933 GAACAGAGCAGGCCCCTGGGTGG - Intergenic
1018908925 6:168090834-168090856 GGACAGAGTAGCCCCCAAGAGGG - Intergenic
1019285323 7:220336-220358 AGCCACAGCAGGCGCCCAGTGGG - Intronic
1019657170 7:2202022-2202044 GGATAGTGCAGGACCCCAGGGGG + Intronic
1020669154 7:11084437-11084459 GAAAAGAGGAGGCCACCAGTAGG - Intronic
1021598563 7:22341963-22341985 GTAGAGAGCTGTCCCCCAGTAGG + Intronic
1022649150 7:32258980-32259002 GGACTGAGGAGGTCCTCAGTAGG + Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1029329440 7:99839702-99839724 CGAGAGAGGGGGCCCCCAGTGGG + Intronic
1029460381 7:100690964-100690986 GGAGAGAGCAGGCCCAGAGCAGG + Intergenic
1029667628 7:102006076-102006098 GGAAGTAGCAGGACCCCAGTGGG + Intronic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1031974456 7:128085003-128085025 GGCCAGAGCAAGGCCCCAGATGG - Intronic
1032420577 7:131775956-131775978 GGGCAGAGCAGGGCCCCTGGCGG - Intergenic
1035291227 7:157840600-157840622 CCACAGAGCAGGCCCCGTGTTGG + Intronic
1037832760 8:22198945-22198967 GGGCAGAGCCTGCCCCGAGTGGG - Intronic
1038039300 8:23710430-23710452 GGGCAGAGCTGGCCCACGGTAGG - Intergenic
1038069377 8:23996622-23996644 GGACACAGTAGGCACTCAGTAGG - Intergenic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1041015934 8:53593522-53593544 GGAAAAAACAGGACCCCAGTTGG + Intergenic
1041865130 8:62563998-62564020 GGACAGAGAAAGCCCACAATTGG + Intronic
1042132961 8:65607169-65607191 GCACAGCACAGGCCCACAGTGGG + Intronic
1043687135 8:83100849-83100871 GGACAGGGGTGGCCACCAGTGGG - Intergenic
1049033068 8:140051297-140051319 GGACAGAGCAGCTCCACACTGGG + Intronic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049213311 8:141396535-141396557 GGCCAGAGCAGGCACACAGTAGG - Intronic
1049724015 8:144137264-144137286 GGACAACACAGGGCCCCAGTGGG - Intergenic
1050016621 9:1240787-1240809 GGAGAGAGCAGGCCCTCATAAGG - Intergenic
1053300124 9:36943019-36943041 GGACATAGCAGGCCCTGGGTAGG - Intronic
1053427363 9:38019305-38019327 GGTCAGAGCAGGTCTCCAGGAGG - Intronic
1054786094 9:69211597-69211619 GGCCAGTGCAGAGCCCCAGTAGG + Intronic
1057305470 9:93909812-93909834 GGGCACAGCAGGCCTCCGGTGGG + Intergenic
1057612420 9:96557227-96557249 GGACGGCACAGGCCCTCAGTGGG - Intronic
1057843134 9:98502278-98502300 GGACAGTGCAGACCCACATTAGG - Intronic
1058504424 9:105653916-105653938 GGATAGAGCAAGACTCCAGTTGG - Intergenic
1058549865 9:106103265-106103287 TGAGAGAGGAGGACCCCAGTAGG + Intergenic
1059455862 9:114399793-114399815 TCACAGAGCAGGCCCTTAGTGGG - Intergenic
1060004022 9:119983688-119983710 GGAAAGATTAGGGCCCCAGTGGG + Intergenic
1061591714 9:131602187-131602209 AGACAGAGCAGCCCCGCAGAGGG - Intronic
1061734015 9:132640050-132640072 GCACAGAGCAGGCATGCAGTAGG - Intronic
1062283580 9:135763025-135763047 AGGCAGAGCAGGCCCTGAGTGGG + Intronic
1062448336 9:136605005-136605027 GGCCTGGGCAGGCCCCCAGGCGG - Intergenic
1062466056 9:136682163-136682185 GGGCGGCGCGGGCCCCCAGTAGG + Intronic
1187274370 X:17805349-17805371 GGACAGACGAGGCCCCTTGTGGG - Intronic
1189381705 X:40506918-40506940 GGACAGGGTAGGCACCCAGCAGG - Intergenic
1193778816 X:85677784-85677806 GGAGAGAGTAGGGCCACAGTCGG + Intergenic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic