ID: 1023729477

View in Genome Browser
Species Human (GRCh38)
Location 7:43176890-43176912
Sequence CTGCTTCGTAATTGCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023729477_1023729478 -5 Left 1023729477 7:43176890-43176912 CCTGCATTGCAATTACGAAGCAG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1023729478 7:43176908-43176930 AGCAGTGCCTGTTCATTTGCAGG No data
1023729477_1023729481 3 Left 1023729477 7:43176890-43176912 CCTGCATTGCAATTACGAAGCAG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1023729481 7:43176916-43176938 CTGTTCATTTGCAGGCTCCTGGG No data
1023729477_1023729480 2 Left 1023729477 7:43176890-43176912 CCTGCATTGCAATTACGAAGCAG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1023729480 7:43176915-43176937 CCTGTTCATTTGCAGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023729477 Original CRISPR CTGCTTCGTAATTGCAATGC AGG (reversed) Intronic
900308340 1:2021760-2021782 CGCCTTGGTAACTGCAATGCTGG + Intronic
902149506 1:14431613-14431635 CTGCTTTGTTCTAGCAATGCTGG - Intergenic
909385652 1:75053323-75053345 CTGCTTCATTATTGCAGAGCAGG - Intergenic
911037628 1:93567222-93567244 CTGTATCGTAATTGAAATGAAGG - Intronic
913177846 1:116291512-116291534 CTACTTTGTTATTGCATTGCAGG - Intergenic
917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG + Intronic
921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG + Intergenic
922943906 1:229493769-229493791 ATGCTTAGGAATTGCTATGCAGG - Intronic
1065655844 10:27949195-27949217 ATGCTTCCTATTTGCCATGCTGG + Intronic
1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG + Intronic
1066458668 10:35594502-35594524 GAGCTTGGTAATTGCATTGCTGG + Intergenic
1067452295 10:46389606-46389628 TTGCCTCTTAATTTCAATGCAGG - Intronic
1067584942 10:47470150-47470172 TTGCCTCTTAATTTCAATGCAGG + Intronic
1071321350 10:84462378-84462400 CTTCTTCCCAACTGCAATGCAGG - Intronic
1072933217 10:99686324-99686346 CTGCATAGTAATTGCAATGAAGG - Intronic
1074807543 10:117068362-117068384 CTGGTTCCTAAATGCAGTGCAGG - Intronic
1084311634 11:68319760-68319782 ATGCTTTGTAATAGCAATGAAGG - Intronic
1090545902 11:127767821-127767843 CTGCAGGATAATTGCAATGCTGG + Intergenic
1090930464 11:131293614-131293636 ATGCTTCCTAACTGGAATGCAGG - Intergenic
1092110189 12:5955194-5955216 CTGCCTGCTAATTGCAATACTGG - Intronic
1120687430 14:87554407-87554429 CTGCTTTGTAATAGCCACGCTGG - Intergenic
1120793348 14:88606186-88606208 CTTCATCGAAATTGTAATGCTGG - Intronic
1121113735 14:91329644-91329666 CTGCTTAGCAACTGCCATGCTGG + Intronic
1124630610 15:31334808-31334830 CTGCTTCTGAATTGCCAAGCTGG - Intronic
1130687155 15:86048713-86048735 ATGCTTCCTCTTTGCAATGCTGG + Intergenic
1134283532 16:12839354-12839376 CTGCTTCCAAAATGCAATGATGG - Intergenic
1143674652 17:8423027-8423049 CTGCTTCGAAATTACAAGGAGGG - Intronic
1158420602 18:57289918-57289940 CTGCTTTGTAACTGAAATTCAGG - Intergenic
1167213059 19:48145642-48145664 CTGCTGCCTCATTGTAATGCCGG - Intronic
927725754 2:25421463-25421485 TTGCTTCCTAACTGCAAAGCAGG - Intronic
931953486 2:67391710-67391732 CTGCTTCATAATTTTAATGAGGG + Intergenic
940281324 2:151992699-151992721 TTGCTTCCTGATTGCAATGGTGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
943805730 2:192122903-192122925 ATGCTTCCTAATTGCATTTCTGG - Intronic
1172600843 20:36181868-36181890 CTGCTTGGAAGTGGCAATGCTGG - Intronic
1174048955 20:47754133-47754155 CTGTTTCCTAATTGCAAGGTTGG - Intronic
1176901682 21:14449753-14449775 CTACTTCATATTTGAAATGCTGG - Intergenic
1178586484 21:33875187-33875209 CTGCTACGTGATTGCCATGTGGG + Intronic
1182420781 22:30247554-30247576 CTGCTTCAGAATGGAAATGCTGG - Intergenic
951699407 3:25479889-25479911 CTTCCTCGTTATTGCACTGCTGG - Intronic
957790710 3:84937358-84937380 CTGCTTCCAAAATGCAATGGTGG - Intergenic
958119384 3:89264220-89264242 CTGCTTCCTAAACACAATGCTGG + Intronic
961522152 3:127473103-127473125 CTGCTTCATAACTGCAGTGCTGG - Intergenic
962050728 3:131812139-131812161 CTGCATCCTAATTGCAATCCTGG - Intronic
965347940 3:167575325-167575347 CTGCTTCTTCATTGAGATGCAGG + Intronic
969255572 4:5999523-5999545 CTGCTTCACAGTGGCAATGCTGG - Intergenic
973086273 4:46065385-46065407 CTGCTTCGAATTTGGAATGATGG - Exonic
974919470 4:68220676-68220698 ATTTTTCGTAATTTCAATGCAGG - Intergenic
978357391 4:107891648-107891670 CTGCTTCCTCAGTGAAATGCAGG + Intronic
991552573 5:67856940-67856962 CTGCTACGTAATTCCACTGATGG + Intergenic
993487266 5:88502290-88502312 CTGGTTCATCATTGCACTGCAGG + Intergenic
1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG + Intronic
1000457182 5:161464952-161464974 CTGCTTCTTAATAGCAGTGGTGG + Intronic
1004830510 6:19472590-19472612 CTAATTCCTAATTGCAATGGAGG - Intergenic
1018106474 6:160492121-160492143 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018107323 6:160501529-160501551 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018130102 6:160721825-160721847 CTTCTGCTTCATTGCAATGCAGG + Intronic
1018967469 6:168499819-168499841 CTCCTTCCTGATTGCACTGCTGG - Intronic
1020677932 7:11202581-11202603 TTGCTTCGCAAGTGCAATGTCGG + Intergenic
1021819589 7:24483303-24483325 CTGCTTTGTGACTGCAATGATGG + Intergenic
1022041138 7:26582457-26582479 CTGCTGCTTAATTCCAAAGCTGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG + Intergenic
1028038029 7:86010177-86010199 CTGCTTAGTAATGTAAATGCAGG + Intergenic
1033619723 7:143051346-143051368 CTGCTTCGTGTTTGCAAAGATGG - Intergenic
1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG + Intergenic
1041904080 8:63012755-63012777 CTGCTTGATTATTGCAATGGAGG + Intergenic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1059188027 9:112294584-112294606 CTTGTTCTTAATTGCAATGGAGG - Intronic
1060712640 9:125884456-125884478 CTGCTTCATAATTGCAAACCTGG - Intronic
1194058885 X:89172327-89172349 CTGCTTTGTTTTAGCAATGCTGG - Intergenic
1202586834 Y:26439206-26439228 CTTCTTCCCAATTTCAATGCAGG - Intergenic