ID: 1023729480

View in Genome Browser
Species Human (GRCh38)
Location 7:43176915-43176937
Sequence CCTGTTCATTTGCAGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023729476_1023729480 5 Left 1023729476 7:43176887-43176909 CCACCTGCATTGCAATTACGAAG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1023729480 7:43176915-43176937 CCTGTTCATTTGCAGGCTCCTGG No data
1023729477_1023729480 2 Left 1023729477 7:43176890-43176912 CCTGCATTGCAATTACGAAGCAG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1023729480 7:43176915-43176937 CCTGTTCATTTGCAGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023729480 Original CRISPR CCTGTTCATTTGCAGGCTCC TGG Intronic
No off target data available for this crispr