ID: 1023733132

View in Genome Browser
Species Human (GRCh38)
Location 7:43210808-43210830
Sequence ACTACTGACTTCCACCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 14, 2: 56, 3: 125, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023733132_1023733140 29 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733140 7:43210860-43210882 TGGACGGCGAGCGAAAGCTCAGG 0: 1
1: 0
2: 2
3: 1
4: 35
1023733132_1023733139 13 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 132
1023733132_1023733136 -7 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733136 7:43210824-43210846 CAGTAGTGGGTCTGCAATGGCGG No data
1023733132_1023733135 -10 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733135 7:43210821-43210843 AGTCAGTAGTGGGTCTGCAATGG No data
1023733132_1023733138 9 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733138 7:43210840-43210862 ATGGCGGTAAATATCAATGGTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1023733132_1023733137 6 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733137 7:43210837-43210859 GCAATGGCGGTAAATATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023733132 Original CRISPR ACTACTGACTTCCACCCCTC TGG (reversed) Intronic
900329771 1:2128230-2128252 ACCACTGCCTTGCACCCATCCGG + Intronic
900824730 1:4917280-4917302 ACTCCTGAGTTCCAGCCCTTTGG + Intergenic
902454930 1:16526408-16526430 ACTAGTGGCTTCCACCCACCTGG - Intergenic
902497236 1:16881487-16881509 ACTAGTGGCTTCCACCCACCTGG + Intronic
904397180 1:30229827-30229849 ACTGCTGACTTCCACCCCTCCGG + Intergenic
907133607 1:52118878-52118900 TCTTCTGACTTCCAGCCCACAGG - Intergenic
907602961 1:55788510-55788532 ACTGTTGACTTCCACCCCTCTGG - Intergenic
908723222 1:67148192-67148214 ACCACTGACTTCCACCCCTCTGG - Intronic
908892685 1:68863881-68863903 GCCACTGACTTCCACCCCTCTGG + Intergenic
909859905 1:80592508-80592530 ATTGCTGACTTCCATCCCTCCGG - Intergenic
910116676 1:83739174-83739196 GTCACTGACTTCCATCCCTCTGG - Intergenic
912285715 1:108366256-108366278 ACCGCTGACTTCCATCCCTCCGG - Intergenic
912379530 1:109239899-109239921 ACCATTGACTTCCTCTCCTCTGG - Intergenic
912463400 1:109852560-109852582 GCCACTGACTTCCGCCCCTCTGG - Intergenic
912552031 1:110490678-110490700 ACCACTGACCTCCACCCCCCAGG + Intergenic
913470778 1:119183094-119183116 GCAGCTGACTTCCAACCCTCTGG - Intergenic
913657926 1:120979162-120979184 ACTAGTGTCTTCCACCCACCTGG - Intergenic
914522501 1:148430440-148430462 ACTAGTGGCTTCCACCCACCTGG - Intergenic
914647906 1:149670886-149670908 ACTAGTGTCTTCCACCCACCTGG - Intergenic
917276726 1:173339044-173339066 ACTAATGACCTAGACCCCTCAGG + Intergenic
917403529 1:174678895-174678917 ACTGCTGACTTCCATCCCTCCGG - Intronic
917413369 1:174783104-174783126 ACCGTTGACTTCCAGCCCTCTGG + Intronic
917476014 1:175369722-175369744 ATTACTTCCTTCCACCGCTCAGG + Intronic
917724029 1:177812799-177812821 GCGGCTGACTTCCACCCCTCCGG + Intergenic
920639848 1:207741482-207741504 ACCGCTGACTTCCATTCCTCCGG - Intergenic
920852390 1:209636885-209636907 ACTACTGACTTCCCCACGTATGG + Intronic
922375419 1:224959066-224959088 ACTACTGACATGCAACCCTCTGG - Intronic
922683927 1:227624841-227624863 ACTGCTGACTTCCATCCCTCTGG - Intronic
922685155 1:227633126-227633148 ACCAATGACTTCCACCCCTCCGG - Intronic
922877773 1:228953926-228953948 GCCACTAACTTCCATCCCTCTGG + Intergenic
922940422 1:229459845-229459867 CATACTGACTTCAACTCCTCTGG + Intronic
923146108 1:231199375-231199397 ACTTCTGACTTGAAACCCTCAGG - Intronic
1063432934 10:6006822-6006844 TTTACTGACTTCAACTCCTCAGG + Intergenic
1065199855 10:23301976-23301998 ACCGCTGACTTCCATCCCTCTGG - Intronic
1066067886 10:31775465-31775487 AGTACTGACTTCCAACACTATGG + Intergenic
1066246833 10:33591928-33591950 GCCACTGACTTCCATCCCTCTGG - Intergenic
1066673012 10:37859421-37859443 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1067158625 10:43803554-43803576 AATACCCACTTCCTCCCCTCAGG - Intergenic
1068191617 10:53659788-53659810 GCCACTGACTTCCATCCCTCCGG + Intergenic
1068791292 10:61034016-61034038 GCCACTGACTTCCACCCCTCCGG - Intergenic
1068792067 10:61039481-61039503 GCCACTGACTTCCACCCCTCCGG - Intergenic
1068988844 10:63130979-63131001 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1069037961 10:63664964-63664986 GCCACTGACTTCCACCCCTCTGG - Intergenic
1070142874 10:73751726-73751748 ACTGCTGACGTCCAGCCCTGTGG + Intronic
1071051878 10:81460197-81460219 GCCACTGACTTCCATCCCTCTGG + Intergenic
1071082700 10:81831276-81831298 GCCGCTGACTTCCGCCCCTCTGG - Intergenic
1071326722 10:84525698-84525720 GCCGCTGACTTCCACCCCTCCGG - Intergenic
1071327411 10:84530638-84530660 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1072315592 10:94199757-94199779 CCTGCTGACTTCCATCCCACAGG - Intronic
1072472432 10:95724693-95724715 ATCACTGACTTCCACCCCTCTGG - Intronic
1072650316 10:97290273-97290295 GCTGCTGACTCCCATCCCTCCGG + Intronic
1072930979 10:99661689-99661711 ACTACTGACTTTGACCCTTTTGG + Intronic
1074978461 10:118599853-118599875 GCCTCTGACTTCCACCCCTCTGG - Intergenic
1076135748 10:128044980-128045002 ACTTCTGAGTTCCAGCCCACTGG - Intronic
1077120218 11:903963-903985 ACCACTGCCTGCCACCCCCCTGG + Intronic
1078884662 11:15488439-15488461 ACTACTGCCTTCCCTACCTCTGG - Intergenic
1079601740 11:22317905-22317927 GCCACTGACTTCCATCCCTCCGG - Intergenic
1079678723 11:23265113-23265135 GCTGCTGACTTCCACCCCTCTGG - Intergenic
1079761855 11:24338963-24338985 GCCGCTGACTTCCACACCTCTGG + Intergenic
1079884281 11:25966525-25966547 GCCACTGACTTCCATCCCTCAGG - Intergenic
1079933252 11:26590779-26590801 GCCACTGACTTCCACCCCTCCGG - Intronic
1081063037 11:38504032-38504054 GCCGCTGACTTCCACCCCTCTGG + Intergenic
1081069734 11:38595829-38595851 GCTGCTGACTTCCATCCCTCTGG - Intergenic
1081070181 11:38602008-38602030 GCCATTGACTTCCACCCCTTTGG + Intergenic
1081070864 11:38606881-38606903 ACCATTGACTTCCACCACTTTGG + Intergenic
1082834366 11:57640677-57640699 ACTACAGGCTCCCACCTCTCTGG + Intergenic
1083107005 11:60368076-60368098 ACCGCTGACTTCTACCCCTCCGG + Intronic
1084696432 11:70758375-70758397 GCCGTTGACTTCCACCCCTCCGG + Intronic
1084708433 11:70829470-70829492 ACGGCTGGCTTCCACCCCTGGGG + Intronic
1085601987 11:77863306-77863328 GCTGCTGACTTCCATCCCTCCGG - Intronic
1085621572 11:78041721-78041743 GCCACTGACTCCCATCCCTCCGG + Intronic
1088110099 11:106251171-106251193 ACCACTGACGTCTATCCCTCTGG + Intergenic
1088242929 11:107789665-107789687 ACCATTGACTTCCACCCCTCCGG + Intergenic
1088484620 11:110328710-110328732 GCCACTGACTTCCACCACTCTGG - Intergenic
1092263467 12:6964247-6964269 ACCTCTGACCTTCACCCCTCTGG + Intergenic
1092293646 12:7181302-7181324 GCTGCTGACTTCCACCCCTCCGG + Intergenic
1093106659 12:15095425-15095447 GCCACTGACTTCCATCCCTCTGG - Intergenic
1095552476 12:43459202-43459224 GCTGCTGACTTCCATCCCTCCGG + Intronic
1096351232 12:50902825-50902847 GCCACTGACTTCCATTCCTCTGG - Intergenic
1096352547 12:50912196-50912218 ACTGCTGACTTCCATCCCTCTGG - Intergenic
1096392669 12:51241229-51241251 ACTACTGACATCCAATACTCAGG + Intronic
1096530112 12:52236978-52237000 ACTACCTAATCCCACCCCTCAGG - Intronic
1097840849 12:64319994-64320016 GCCACTGACTTCCATCCCTCCGG + Intronic
1098984876 12:77001484-77001506 GCCGCTGACTTCCACCCCTCCGG + Intergenic
1099292619 12:80790109-80790131 GCCACTGACTTCCATCCCTCTGG + Intergenic
1099505319 12:83468744-83468766 ACCACTGACCCCCACCCCTCTGG - Intergenic
1099605037 12:84794127-84794149 GTAACTGACTTCCACCCCTCCGG + Intergenic
1099798628 12:87429612-87429634 GCCACTGACTTCCACCCCTCTGG - Intergenic
1100108125 12:91203173-91203195 ACTACTCACCTCCAACACTCTGG + Intergenic
1100205062 12:92339671-92339693 ACTGCTGACTTCCATGCCTCTGG - Intergenic
1103802559 12:123548829-123548851 GTCACTGACTTCCACCCCTCCGG + Intergenic
1103872338 12:124100806-124100828 GCCACTAACTTCCACCCCTCCGG - Intronic
1103873176 12:124105981-124106003 AGCCCTGACTTCCACCCCTCCGG - Intronic
1104388012 12:128367452-128367474 ACTATTGTTTTCCAACCCTCTGG - Intronic
1104850964 12:131873528-131873550 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1107156424 13:37172371-37172393 GCTGCTGACTTCCATCCCTCCGG - Intergenic
1107315919 13:39131761-39131783 ACTATTGCCTTCCACCCGTGGGG + Intergenic
1107700914 13:43046813-43046835 GCCGCTGACTTACACCCCTCTGG + Intronic
1108374924 13:49805180-49805202 ATTACTGACTACCACCACACAGG - Intergenic
1109520628 13:63505550-63505572 GCCTCTGACTTCCATCCCTCTGG - Intergenic
1109680713 13:65748436-65748458 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1109931300 13:69222047-69222069 GCTGCTGACTCCCATCCCTCCGG + Intergenic
1110846146 13:80192464-80192486 ACCGCTGACTTCCATCCCTCCGG + Intergenic
1111021445 13:82457717-82457739 ACCACTGACTCCCATCCCTCCGG + Intergenic
1111090489 13:83439619-83439641 ACGGCAGACTTCCACCCCTAGGG + Intergenic
1111536793 13:89612085-89612107 ACTGCTAACTTCCATCCCTCTGG - Intergenic
1111820401 13:93206928-93206950 ACTGCTGACTTCCATCCCTCCGG + Intergenic
1111910270 13:94303040-94303062 ACTGCTGACTCCCACCCCTCCGG - Intronic
1113358989 13:109610773-109610795 CCTACTGCTTCCCACCCCTCAGG + Intergenic
1113368036 13:109696136-109696158 ACTCCTGTCTTCCACCCCCATGG - Intergenic
1116862555 14:50006286-50006308 AACACTGACTTCCATGCCTCTGG + Exonic
1117171813 14:53108160-53108182 GCCGCTGACTTCCATCCCTCCGG + Intronic
1118615710 14:67573254-67573276 TCTACACCCTTCCACCCCTCAGG + Exonic
1119727858 14:76932995-76933017 ACAGCTGCCTCCCACCCCTCTGG - Intergenic
1120009213 14:79393967-79393989 ATTTCTGACTTCCACCCTACTGG - Intronic
1120097381 14:80403895-80403917 TCCACTGACTTCCATCCCTCTGG + Intergenic
1120107982 14:80517942-80517964 GCCACTGACTTCCACCCCTCTGG - Intronic
1120397387 14:83985616-83985638 ACCGCTGACTTCCATCCCTCTGG + Intergenic
1120857341 14:89223722-89223744 CCCCCTGACTTCCACACCTCAGG - Intronic
1122366713 14:101198701-101198723 CCTCCTGACTTCCAGCCCTGTGG + Intergenic
1123125464 14:105942901-105942923 ACCGCTGGCTTCCATCCCTCCGG + Intergenic
1123496769 15:20834407-20834429 ACTCCTAACTTACACCTCTCTGG - Intergenic
1123554002 15:21407999-21408021 ACTCCTAACTTACACCTCTCTGG - Intergenic
1123590248 15:21845364-21845386 ACTCCTAACTTACACCTCTCTGG - Intergenic
1123987296 15:25657065-25657087 TCCATTGACTTCCACCCCTCCGG + Intergenic
1126687461 15:51261002-51261024 ACCATTGACTCCCACCTCTCCGG + Intronic
1126728338 15:51655600-51655622 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1127074514 15:55312201-55312223 GCCGCTGACTTCCATCCCTCCGG - Intronic
1127852729 15:62928222-62928244 ACTACTGCCTTCCATCCTTAAGG + Intergenic
1127973914 15:63983398-63983420 ACCACTGACTTCACCTCCTCTGG + Intronic
1128363107 15:66976448-66976470 ACCACTGACTTCCACCCCTCCGG - Intergenic
1128800613 15:70494632-70494654 AGTCCTTACTTCCACCCCTGTGG + Intergenic
1131673851 15:94651174-94651196 GCCACTGACTTCCATCCCTCTGG + Intergenic
1202962350 15_KI270727v1_random:135195-135217 ACTCCTAACTTACACCTCTCTGG - Intergenic
1132674553 16:1116337-1116359 ATTCCTGACTTCTACCCATCAGG - Intergenic
1133379906 16:5321244-5321266 GCTTCTCACTCCCACCCCTCAGG - Intergenic
1133515420 16:6504107-6504129 ACTACTGACTACCTTACCTCTGG - Intronic
1137365948 16:47859548-47859570 CCTACTGACTTCCACCCACAAGG + Intergenic
1140061930 16:71578077-71578099 ACTACTGTATTCAACCCCACTGG - Intergenic
1141298460 16:82791631-82791653 GTGGCTGACTTCCACCCCTCTGG + Intronic
1142384801 16:89756908-89756930 ACTATTGAAGTCAACCCCTCAGG + Intronic
1142488998 17:265901-265923 TCTGCTGACTTCCACCCCACAGG + Intronic
1143411845 17:6713825-6713847 TCTCCTTACTTCCGCCCCTCCGG + Intergenic
1143476513 17:7206498-7206520 TGTACTAACTACCACCCCTCAGG + Intronic
1143653383 17:8278279-8278301 ACCACTGAAGTCAACCCCTCAGG - Intergenic
1148371989 17:47106725-47106747 GCCACTGACTTCCATTCCTCCGG - Intergenic
1148826726 17:50399291-50399313 GCTGCTGACTTCCACCCCTCTGG - Intergenic
1151017851 17:70577621-70577643 ACTGTTGACTTCCACACCCCCGG + Intergenic
1153400779 18:4682081-4682103 ACTGCTGACTTCTGTCCCTCTGG + Intergenic
1154454674 18:14510091-14510113 ACTGCTAACTTACACCTCTCTGG - Intronic
1155749235 18:29399205-29399227 CTTGCTGACTTCCATCCCTCCGG - Intergenic
1156662248 18:39359393-39359415 CGTGCTGACTTCCACCCCTCAGG - Intergenic
1157782201 18:50449478-50449500 GCCACTGACTTCCATCCCTTCGG - Intergenic
1159522535 18:69544740-69544762 ATTACTGACTTTCACCTCTATGG + Intronic
1159530805 18:69652952-69652974 ACTACAGACATCATCCCCTCAGG - Intronic
1161743918 19:6043103-6043125 ACATTTGACTTCCACCCCTGGGG - Intronic
1164536054 19:29087383-29087405 AATACTGGCTTCCTCACCTCTGG - Intergenic
1165823199 19:38690300-38690322 ACTGTTGACTTCCACCCCTCCGG + Intronic
1166014319 19:39968895-39968917 GCCGCTGACTTCCACCCCTCCGG + Intergenic
1166165567 19:40985917-40985939 GCCACTGACTTCCACCCGTCCGG + Intergenic
1166627363 19:44370988-44371010 TATACTGACTTCCATGCCTCTGG - Intronic
1168307595 19:55443754-55443776 ACCACTGACTTACACCCCTATGG + Intergenic
924973617 2:153866-153888 ACCACTGACTTCCACCCCTCCGG - Intergenic
924974504 2:160350-160372 GCCACTGACTTCCACCCCTCCGG - Intergenic
926730844 2:16034382-16034404 ACTGCTGCCCTCCACCCCCCAGG - Intergenic
926864988 2:17346345-17346367 ACTGCTGACTTCCATTCTTCTGG + Intergenic
926904803 2:17795690-17795712 ATTACTGGGTTCCACCCCACTGG + Intronic
927486464 2:23491636-23491658 ATCACTGTCTTCCAGCCCTCCGG + Intronic
928319126 2:30269296-30269318 GCCGCTGACTTCCATCCCTCTGG + Intronic
928348191 2:30519914-30519936 GCCATTGACTTTCACCCCTCTGG + Intronic
928402505 2:30989262-30989284 ACCACTCACTTCCACTTCTCTGG + Intronic
928440105 2:31285126-31285148 GCCGCTAACTTCCACCCCTCCGG + Intergenic
928671902 2:33610996-33611018 ACCATTGACTTCCACCCCTCCGG - Intergenic
928676635 2:33657577-33657599 GCTGCTGACTTTCACCCCTCCGG + Intergenic
928773663 2:34732749-34732771 TCTGCTGACTTCCATCCCTCTGG - Intergenic
932770871 2:74500092-74500114 ACTAATCACTTCCAGCCGTCAGG - Intronic
932917179 2:75872089-75872111 GCCACTGACTTCTATCCCTCCGG + Intergenic
932918185 2:75879127-75879149 ACTGCTGAGTTCTATCCCTCCGG + Intergenic
933121768 2:78547013-78547035 CCCGTTGACTTCCACCCCTCTGG - Intergenic
933175731 2:79170182-79170204 GCCACTGACTCCCATCCCTCAGG - Intergenic
933328833 2:80871723-80871745 GCTGCTGACTCCCATCCCTCTGG + Intergenic
933500208 2:83101800-83101822 GCTGCTGACTCCCATCCCTCCGG + Intergenic
933556335 2:83835389-83835411 TCTGCTGACTTCCATCCCTCTGG - Intergenic
934052353 2:88221291-88221313 ACAACTGAGTTCCAACCCTCCGG + Intergenic
935748352 2:106209363-106209385 GCTACTGACTTCCACCCCTCCGG + Intergenic
936387734 2:112044812-112044834 GCCACTGACTTCCATCCCTCTGG - Intergenic
936868893 2:117109691-117109713 GCCACTGATTTCCATCCCTCAGG + Intergenic
937482554 2:122277489-122277511 ACTAATGAATTGCAACCCTCAGG - Intergenic
937758684 2:125573047-125573069 CCTACTCCCTTCCACCTCTCTGG + Intergenic
939134082 2:138273484-138273506 ACCGCTGATTTCCATCCCTCTGG - Intergenic
939492967 2:142899004-142899026 ACCATTGACTCCCACCCCTCTGG - Intronic
939493155 2:142900252-142900274 ACCACTGACTTCCACCTCTCTGG - Intronic
939494103 2:142907465-142907487 GCCATTGACTCCCACCCCTCTGG - Intronic
940669044 2:156645176-156645198 ACCACTGACTCCCATCCCTCCGG + Intergenic
941851126 2:170182478-170182500 ACTACTTATTTCTACCCCTGTGG + Intronic
942830310 2:180232090-180232112 GCCATTGACTTCCACCCCTCAGG + Intergenic
942831228 2:180238949-180238971 ACCATTGACTTCCACCCCTCCGG + Intergenic
943160422 2:184243012-184243034 TTAACTGACTTCCACACCTCTGG - Intergenic
944039789 2:195339905-195339927 GCCATTGACTTCCACCCCTCCGG - Intergenic
945064776 2:205939577-205939599 CCCGCTGACTTCCATCCCTCCGG + Intergenic
945395002 2:209306621-209306643 GCCGCTGACTTCCATCCCTCCGG + Intergenic
948287813 2:236800690-236800712 ACTTCTGACTTGCACCCTCCAGG - Intergenic
948517647 2:238514233-238514255 GCCGCTGACTTCCACCCCTCTGG + Intergenic
1170395978 20:15926033-15926055 ACTAATGACTTACAGCCTTCTGG - Intronic
1171500790 20:25591457-25591479 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1172909288 20:38394614-38394636 ACTTCTGACTTCTAGCCTTCAGG + Intergenic
1172947199 20:38698780-38698802 GCCGCTGACTTCCACCCCTCTGG + Intergenic
1173932541 20:46832874-46832896 ACTACGGACTCCCACCCCATGGG + Intergenic
1175748021 20:61475256-61475278 ACTTCTTAATTCCACCCCTGTGG - Intronic
1176819491 21:13643217-13643239 ACTGCTAACTTACACCTCTCTGG + Intergenic
1177263008 21:18753090-18753112 GCCACTGACTCCCATCCCTCCGG - Intergenic
1177359356 21:20048614-20048636 GCCACTGACTTCCACCCCTCCGG - Intergenic
1177738128 21:25118811-25118833 GCCGCTGACTTCCACCCCTCCGG + Intergenic
1179444720 21:41423207-41423229 ACCACTGATGTCCACCCCTCTGG - Intronic
1182895801 22:33858252-33858274 GCCGCTGACTTCCATCCCTCTGG - Intronic
1184440397 22:44508910-44508932 ACTACTGCATTCCAGCCCTGTGG + Intergenic
1184680584 22:46070694-46070716 AGTCCGGACTCCCACCCCTCTGG + Intronic
949811669 3:8012936-8012958 GCGGCTGACTTCCATCCCTCTGG - Intergenic
950865813 3:16188250-16188272 ACTTCTCACTTCCACCACTGGGG - Intronic
952251708 3:31662482-31662504 ACCAGTGACTTCCAGCCCACAGG + Intronic
952921712 3:38289746-38289768 GCCGCTGACTTCCACCCCTCCGG - Intronic
953505900 3:43485296-43485318 GCTGCTGACTTCCATACCTCCGG + Intronic
954096966 3:48336065-48336087 ACCATTGGCTTCCACACCTCCGG - Intergenic
954144228 3:48626441-48626463 ACCCCTGACCTCCACCCCTGAGG + Intronic
955381272 3:58440188-58440210 GCTGCTGACTTCCACCCCTCTGG - Intergenic
955880537 3:63539884-63539906 CCCACTGACTTCCACCCTCCAGG + Intronic
957000502 3:74877909-74877931 GCTGCTGACTTCCATCCCTCCGG - Intergenic
957557727 3:81782332-81782354 ACTGCTGACTTCCACCCCTCTGG + Intergenic
957687046 3:83515323-83515345 GCCGCTGACTTCCATCCCTCCGG + Intergenic
957739649 3:84248111-84248133 ACTACAGACTTGCAGCCCACAGG + Intergenic
957895111 3:86411992-86412014 GCTGCTGGCTTCCACCCTTCTGG + Intergenic
958016743 3:87946203-87946225 GCCGCTGACTTCCACCCCTCTGG - Intergenic
958091891 3:88886804-88886826 GCTGCTGACTTCCACCCCTCTGG - Intergenic
958424507 3:93965306-93965328 GCTGCTGACTCCCATCCCTCCGG + Intronic
958457046 3:94345282-94345304 GCTGCTGACTTCCACCGCTCCGG - Intergenic
958629243 3:96666798-96666820 GCTGCTGACTACCATCCCTCTGG - Intergenic
958630364 3:96675016-96675038 GCTGCTGACTTACATCCCTCCGG - Intergenic
959161770 3:102732784-102732806 GCCACTGACTTCCATCCCTCCGG - Intergenic
960959789 3:123062135-123062157 ACTACTGACATCCTTCCCCCTGG + Intergenic
961133183 3:124487703-124487725 AATGCTGACTTCCATCCCACTGG - Intronic
961928070 3:130504329-130504351 ACTGCGGACCTCCAGCCCTCAGG + Intergenic
963255684 3:143142520-143142542 GCCGCTGACTTCCACCCCTCCGG + Intergenic
963915314 3:150854406-150854428 GCCGCTGACTTCCATCCCTCTGG + Intergenic
965342130 3:167503674-167503696 ACCGCTGACTTCCATCCCTCTGG - Intronic
965506548 3:169521555-169521577 ACCACTGACCTTCACACCTCTGG - Intronic
966511220 3:180765640-180765662 ACCATTGACTTTCACCCCTCCGG - Intronic
966994310 3:185265048-185265070 GCTGTTGACTCCCACCCCTCCGG + Intronic
967162555 3:186751697-186751719 AATACTGAGCTCCACACCTCTGG + Intergenic
967389158 3:188938550-188938572 ACCGCTGACTTCCATCCCCCTGG - Intergenic
968390870 4:192110-192132 ACCACTGACTTCCAACCTTCTGG - Intergenic
969644665 4:8420778-8420800 ACCACTGACTTCCACCCCTCCGG + Intronic
970224783 4:13846388-13846410 CCTACTGACTTCCCCACCTTTGG + Intergenic
970738110 4:19198106-19198128 GCCGCTGACTTCCATCCCTCTGG - Intergenic
972766769 4:42158535-42158557 GCCACTGACTTCCATCCCTCTGG - Intergenic
973205067 4:47550815-47550837 GCCGCTGACTTCCACCCCTGCGG - Intronic
973245873 4:48010804-48010826 GCTGCTGACTTCCATCCCTCTGG - Intronic
974190480 4:58496519-58496541 GCTGTTGACTTCCACCCCTCTGG - Intergenic
974487286 4:62522464-62522486 GCAGCTGACTTCTACCCCTCCGG + Intergenic
974487848 4:62526862-62526884 GCCACTGACTTCCATCCCTCTGG - Intergenic
974519963 4:62971428-62971450 ACAACTGACTTCCAGCCCTCCGG + Intergenic
974648495 4:64724949-64724971 GCCACTGACTACCACCCCTCTGG - Intergenic
975313223 4:72925992-72926014 GCTGCTGACTTCCATCCCTCTGG - Intergenic
975314188 4:72932754-72932776 GCTGCTGACTTCCATCCCTCCGG - Intergenic
975418816 4:74138643-74138665 TCCATTGACTTCCACTCCTCCGG - Intronic
976189292 4:82473727-82473749 ACCACTGACTTCCACCCCTCCGG + Intergenic
976190171 4:82479748-82479770 GCCGCTGACTTCCACCCCTCCGG + Intergenic
976464848 4:85355208-85355230 GCCACTGACTTCCACCCCTCCGG - Intergenic
977251323 4:94692660-94692682 GCCGCTGAATTCCACCCCTCTGG + Intergenic
977556179 4:98489613-98489635 ACCACTGACTTCCACCCCTCCGG + Intronic
978909023 4:114044533-114044555 ACCGCTGACTTCCATCCCTCCGG + Intergenic
979883511 4:125993305-125993327 GCCATTTACTTCCACCCCTCGGG + Intergenic
980190523 4:129519360-129519382 GCTGCCGACTTCCATCCCTCTGG + Intergenic
980386300 4:132090738-132090760 GCCTCTGACTTCCATCCCTCTGG - Intergenic
980625718 4:135372333-135372355 GCCCCTGACTTCCATCCCTCTGG + Intergenic
981221108 4:142236162-142236184 GCTACTGTCTTCAACCCTTCAGG + Intronic
981740761 4:147999469-147999491 ACCACTGACTTCCATCCCTCCGG + Intronic
982978789 4:162104103-162104125 ACTGCTGACTTCCATCCCTCCGG + Intronic
983777798 4:171629915-171629937 GCCGCTGACTTCCATCCCTCTGG + Intergenic
985226360 4:187765552-187765574 GCTGCTGACTCCCATCCCTCCGG + Intergenic
986492615 5:8307813-8307835 ACCGTTGACTTCCACACCTCAGG - Intergenic
986918837 5:12660729-12660751 GCTGCTGAGTTCCATCCCTCCGG - Intergenic
987508230 5:18800459-18800481 GCTGCTGACTTCCATCCCTCCGG + Intergenic
987719412 5:21615319-21615341 GCCGCTGACTTCCACCCTTCTGG - Intergenic
987761179 5:22164450-22164472 TCCGCTGACTTCCATCCCTCAGG - Intronic
987855129 5:23411335-23411357 ATCACTGACTTCCACCCCTCCGG + Intergenic
987905353 5:24069402-24069424 GCCACTGACTTCCACCCCTCTGG + Intronic
987934914 5:24451323-24451345 TCCGCTGACTTCCACCCCTCCGG - Intergenic
988099682 5:26660317-26660339 GCCGCTGACTTCCACCCCTCCGG - Intergenic
988182550 5:27816280-27816302 GCCATTGACTTCCACCCCTCTGG - Intergenic
988881480 5:35508163-35508185 GCTGTTGACTTCCACCCCTCTGG + Intergenic
989658895 5:43777042-43777064 AATACTGACTTCCTTCCCTTTGG + Intergenic
989688433 5:44114706-44114728 GCTGCTGACTTCCATCCCTTTGG + Intergenic
989717702 5:44483527-44483549 GCTGCTGACTTCCACCCCTCTGG + Intergenic
990891812 5:60658906-60658928 GCCACTGACTTCCACCCCTCCGG + Intronic
990905182 5:60795650-60795672 GCCACTGACTTCCAACCCTCCGG + Intronic
991895969 5:71397904-71397926 TCCGCTGACTTCCATCCCTCAGG - Intergenic
992214489 5:74512427-74512449 ACTACTGAATACAACCCATCTGG + Intergenic
992293498 5:75304605-75304627 GACCCTGACTTCCACCCCTCTGG + Intergenic
993054984 5:82970953-82970975 GCTGCTGACTTCCATCCCTCCGG - Intergenic
993305767 5:86272986-86273008 ATGGCTGACTTCCATCCCTCCGG - Intergenic
993941853 5:94068357-94068379 GCCACTGACTTCCACCCCTCCGG - Intronic
993982341 5:94557927-94557949 GCTGCTAACTTCCATCCCTCTGG + Intronic
995717282 5:115092651-115092673 GCTGCTGACTTCCACCCCTCCGG + Intergenic
995853050 5:116566800-116566822 ACTACTGCCTTCCACACCAAAGG - Intronic
997424345 5:133793119-133793141 ACAACTGAGGCCCACCCCTCAGG + Intergenic
998122120 5:139587304-139587326 GCTGCTGACTTCCATCCCTCCGG - Intronic
1000095455 5:157967405-157967427 GCCGCTGACTTCCATCCCTCCGG + Intergenic
1000654437 5:163859326-163859348 ACAATTGAATTCGACCCCTCAGG + Intergenic
1001597153 5:172905663-172905685 ACCGCTGACTTCCACCCCTCTGG - Intronic
1001955520 5:175845911-175845933 CCTCCTGGCTTCCACCCCTCTGG + Intronic
1004007315 6:11649072-11649094 GCCTCTGACTTCCACCCCTCTGG + Intergenic
1004256415 6:14068843-14068865 GCCGCTGACTTCCATCCCTCCGG + Intergenic
1004339335 6:14794609-14794631 AGCACTGACTCCCACCCCTATGG - Intergenic
1005324135 6:24682641-24682663 ACCACTGACTCCCATCCCTCCGG - Intronic
1008505699 6:52227576-52227598 AACACTGACTTCCTCCCCTTGGG + Intergenic
1008582771 6:52921482-52921504 GCCACTGACTTCCATACCTCTGG - Intergenic
1008763015 6:54877066-54877088 ACTGCTAATTTCTACCCCTCTGG - Intronic
1009023936 6:57974999-57975021 GCCACTGACTTCCACCCATCTGG + Intergenic
1009702463 6:67201749-67201771 ACCGCTGACTTCCACCCCTCTGG + Intergenic
1009885209 6:69617060-69617082 GCCGCTGACTTCAACCCCTCTGG + Intergenic
1011076390 6:83443915-83443937 GCCACTGACTTTCACCCCTCCGG + Intergenic
1011189084 6:84712032-84712054 GCCATTGACTTCCACCCCTCTGG - Intronic
1011190318 6:84720719-84720741 ACCGTTGACTTCCACCCCTCTGG - Intronic
1012120019 6:95354765-95354787 GCCACTGACTTCCACCCCTCCGG + Intergenic
1012734536 6:102921667-102921689 ACTACTGACTTCCATCCCTCCGG - Intergenic
1013021760 6:106228290-106228312 GCCACTGACTTCCATCCCTCTGG + Intronic
1013410510 6:109879635-109879657 GCCACTGACTTCCACCCCTCTGG + Intergenic
1013543077 6:111131173-111131195 GCCGCTGACTTCCACCCCTCTGG + Intronic
1014243343 6:119041693-119041715 GCCGCTGACTTCCACCCCTCCGG + Intronic
1014758362 6:125327044-125327066 ACTTCTGACCTTCCCCCCTCTGG + Intergenic
1015632769 6:135247980-135248002 ACCACTGACTTCCACCCCTCTGG + Intergenic
1016343647 6:143087532-143087554 GCCGCTGACTTCCATCCCTCTGG - Intronic
1016411704 6:143790094-143790116 ACCACAGGCTTCCACCCATCAGG - Intronic
1016444922 6:144121388-144121410 ACCGCTGACTTCCACCCCTCCGG - Intergenic
1017913148 6:158812421-158812443 ACTAATGACTTCCATCTCTAGGG - Intronic
1018760554 6:166891228-166891250 GCCGCTGACTTCCATCCCTCCGG + Intronic
1018808004 6:167276333-167276355 TATACTGACTTCCTTCCCTCTGG + Intronic
1020149808 7:5673188-5673210 ACCACTGACTTCCCCCGCTTGGG - Intronic
1020756921 7:12214373-12214395 TCTGCTGACTTCAACTCCTCAGG + Exonic
1021885337 7:25131917-25131939 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1022989919 7:35696675-35696697 ACAGCTGACTTCCATCCCTCTGG + Intergenic
1023439770 7:40173332-40173354 GCCGCTGACTTCCACCCCTCCGG - Intronic
1023733132 7:43210808-43210830 ACTACTGACTTCCACCCCTCTGG - Intronic
1023886328 7:44359907-44359929 ACTGCTGACTTACATCTCTCTGG - Intergenic
1024165479 7:46725054-46725076 ATTACTGACTTGCATCTCTCTGG + Intronic
1026213085 7:68324145-68324167 GCTGCTGACTCCCATCCCTCCGG + Intergenic
1028147063 7:87330038-87330060 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1028926148 7:96358687-96358709 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1028993391 7:97074826-97074848 GCTGCTGACTTCCATCCCTCCGG + Intergenic
1029015973 7:97315967-97315989 GCCACTGACTTCCATCCCTCTGG + Intergenic
1030208392 7:106972743-106972765 GCCACTGACTTTCACCCCTCCGG - Intergenic
1030336811 7:108337440-108337462 ACTGCTGACTTCCATCCCTCTGG + Intronic
1031250872 7:119378920-119378942 GCTGCTGACTTCCACCCCTCTGG - Intergenic
1031472002 7:122177225-122177247 GCCACTGACTTCCACCCCTCCGG + Intergenic
1031742822 7:125455909-125455931 GCTGCTGACTTCCATCCCTCCGG - Intergenic
1032725344 7:134585833-134585855 TCCATTGACTTCCACCTCTCTGG + Intergenic
1032726296 7:134592666-134592688 TCCATTGACTTCCACCTCTCTGG + Intergenic
1033755377 7:144394990-144395012 TCTCCTGACTTCTGCCCCTCTGG + Intergenic
1034248770 7:149671731-149671753 GCCACTGACTTCCACCCCTCTGG + Intergenic
1034650841 7:152688831-152688853 GCCACTGACTTCCATCCCTCCGG - Intergenic
1034707075 7:153155174-153155196 ACCACTGACTTCCACCCCTCTGG - Intergenic
1037379955 8:18274626-18274648 ACCGTTGACTTCCACCCCTCAGG - Intergenic
1037648687 8:20817030-20817052 GCCACTGACATCCATCCCTCCGG - Intergenic
1038556839 8:28526008-28526030 ATTCTTGACTTCCACTCCTCAGG - Intronic
1038742248 8:30225912-30225934 CCCGCTGACTTCCATCCCTCTGG - Intergenic
1040768449 8:50944271-50944293 GCTGCTGACTTCCACCCCTCCGG - Intergenic
1041664090 8:60425342-60425364 ATCACTGACTTCCACCCCTCGGG - Intergenic
1042055658 8:64763111-64763133 GCCACTGACTTCCACCCCTCCGG + Intronic
1042292930 8:67188689-67188711 GCCACTGACTTCCACCCCTCCGG + Intronic
1044988289 8:97774167-97774189 GCCGTTGACTTCCACCCCTCTGG - Intergenic
1045785192 8:105912733-105912755 ACAACTCACTTCCACTCCCCCGG - Intergenic
1045863513 8:106839360-106839382 GCCATTGACTCCCACCCCTCAGG - Intergenic
1046699935 8:117388734-117388756 ACTACTCACTTTCACTCCTCAGG - Intergenic
1047443557 8:124900111-124900133 ACTGTTGACTTTCACCCCTCTGG - Intergenic
1047618316 8:126581357-126581379 GCTGCTGACTTCCACCCCTCCGG + Intergenic
1047996469 8:130341491-130341513 ACTGCTGACTGCCAAGCCTCAGG + Intronic
1048100255 8:131343196-131343218 GCCACTGACTTCCACCCTTCTGG - Intergenic
1048272125 8:133037889-133037911 CCAACTGACTTCCACCCATATGG + Exonic
1048631495 8:136247681-136247703 TCCGCTGACTTCCACCCCTCTGG + Intergenic
1049073683 8:140376798-140376820 ACTGCTAACTTCCACCTCCCAGG - Intronic
1049443881 8:142621398-142621420 ACTGCTGGCCTCCACACCTCGGG - Intergenic
1050116055 9:2264571-2264593 ACTGCTGACTTCCACCCCTCCGG - Intergenic
1050593503 9:7183577-7183599 ACCACTGACTTCCATCCCTCTGG + Intergenic
1051748009 9:20313876-20313898 TCTAGTGACTTACACCCATCAGG - Intergenic
1051970173 9:22878041-22878063 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1053215195 9:36265045-36265067 GCCGCTGACTTCCACCCCTCCGG + Intronic
1055049593 9:71965002-71965024 ACCACTGACTTCCATCCCTCTGG - Intronic
1055455699 9:76469641-76469663 GCCACTGACTTCCATCCCTCTGG + Intronic
1056705010 9:88944247-88944269 ACCGCTGACTTCCATCCCTCTGG - Intergenic
1058231952 9:102436791-102436813 ACCGCTGACTTCCATCCCTCCGG - Intergenic
1203527867 Un_GL000213v1:106353-106375 ACTGCTAACTTACACCTCTCTGG - Intergenic
1185560915 X:1060108-1060130 ACCTTTGAGTTCCACCCCTCCGG + Intergenic
1186254532 X:7703891-7703913 ACTGCTGACTTCCATCCCTCTGG - Intergenic
1187558109 X:20372532-20372554 ACTAAGGACTACCACCCCTAAGG + Intergenic
1187613822 X:20971890-20971912 GCTGCTGACTTCCATCCCTCAGG + Intergenic
1189954273 X:46261967-46261989 ACCGCTGACTTCCATCCCTCCGG - Intergenic
1191167483 X:57405526-57405548 GCCACTTACTTCCACCACTCTGG - Intronic
1192803105 X:74485850-74485872 ACTTCTGACTTCCACCCCTCCGG - Intronic
1192940367 X:75904897-75904919 GCCACTGACTTCCATCCCTCTGG - Intergenic
1193172382 X:78350339-78350361 GCTGCTGACTTCCTCCCCTCTGG - Intergenic
1193295491 X:79827534-79827556 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1194103277 X:89734553-89734575 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1194154502 X:90370266-90370288 ACCACTGACTTCCATCTCTCTGG - Intergenic
1194285677 X:92007595-92007617 TCTACTGACCTCCACCCCTGTGG + Intronic
1195156850 X:102131863-102131885 TCACCTGACTTCCACCACTCTGG - Intergenic
1195243672 X:102977845-102977867 ACCATTGACTTTCACCCCTCCGG + Intergenic
1195256576 X:103096808-103096830 GCTGCTGACTTCCACCCCTCCGG + Intergenic
1195505078 X:105647201-105647223 ATCGCTGGCTTCCACCCCTCCGG - Intronic
1195584607 X:106551425-106551447 GCCGCTGACTTCCATCCCTCTGG + Intergenic
1196287275 X:113897437-113897459 GCTGCTGACTCCCATCCCTCCGG - Intergenic
1196772522 X:119309122-119309144 GCCACTGACTTCCATCCCTCCGG - Intergenic
1197545324 X:127816570-127816592 ACCGCTGACTTCCATCCCTCCGG - Intergenic
1199536303 X:148906805-148906827 GCCCTTGACTTCCACCCCTCCGG + Intronic
1200500855 Y:3947159-3947181 ACCACTGACTTCCATCTCTCTGG - Intergenic
1200603240 Y:5232134-5232156 TCTACTGACCTCCACCCCTGTGG + Intronic
1200851261 Y:7886374-7886396 GCCACTGACTTCCACCCCTCTGG - Intergenic
1201905232 Y:19080350-19080372 GCCACTGACTTCCATCCCTCTGG + Intergenic