ID: 1023733139

View in Genome Browser
Species Human (GRCh38)
Location 7:43210844-43210866
Sequence CGGTAAATATCAATGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023733132_1023733139 13 Left 1023733132 7:43210808-43210830 CCAGAGGGGTGGAAGTCAGTAGT 0: 1
1: 14
2: 56
3: 125
4: 221
Right 1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 132
1023733128_1023733139 24 Left 1023733128 7:43210797-43210819 CCCTGCCAGATCCAGAGGGGTGG 0: 10
1: 46
2: 99
3: 132
4: 299
Right 1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 132
1023733131_1023733139 19 Left 1023733131 7:43210802-43210824 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 132
1023733130_1023733139 23 Left 1023733130 7:43210798-43210820 CCTGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG 0: 1
1: 0
2: 0
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023733139 Original CRISPR CGGTAAATATCAATGGTGGA CGG Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910360231 1:86408765-86408787 CGGTAAATGTCTGGGGTGGAGGG + Intergenic
913049369 1:115103423-115103445 AGGTACATATAAAAGGTGGATGG - Intergenic
913523931 1:119672879-119672901 CGCTACAAATCAGTGGTGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078764951 11:14287419-14287441 GGGTAAATATGATTGGGGGAAGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1098190064 12:67938511-67938533 TGGTGGACATCAATGGTGGAAGG + Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1107200160 13:37705697-37705719 AGGTAAATATGCATGCTGGAAGG - Intronic
1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG + Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109748832 13:66663286-66663308 CAATAAATATTAATGGTGAAAGG - Intronic
1110049004 13:70871067-70871089 CAGCAAATATAAATGATGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1114773974 14:25460591-25460613 GTGTAGATGTCAATGGTGGAGGG - Intergenic
1116595142 14:46832345-46832367 CGGTCAATAGAGATGGTGGAAGG - Intergenic
1116713196 14:48396114-48396136 TGGTAATTCTCAATGTTGGAGGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1136670190 16:31849664-31849686 AGGTAAAAATAAATGGTGTAAGG + Intergenic
1139026133 16:62820469-62820491 CGGTAAATATTAAAGGAAGACGG + Intergenic
1139072312 16:63397876-63397898 CAGTAAATATTAATGATGGGAGG - Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153735863 18:8066537-8066559 GGGTCAATATCAATGGGGGTAGG - Intronic
1156400963 18:36740090-36740112 TGGTAAAAATCAATTGTGGAAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1167279849 19:48560518-48560540 CGGTATATATCTATGGAGGGTGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168386502 19:55967701-55967723 GGGTATATACCAGTGGTGGATGG + Intronic
927451473 2:23212882-23212904 AGGAAAATATCAAGTGTGGATGG - Intergenic
928803261 2:35119938-35119960 TGCTGAATATCAATGGTGAAAGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933512178 2:83254826-83254848 CTGTTGATATCATTGGTGGATGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
944938018 2:204589981-204590003 TGGGAAATATCAAGGGAGGAAGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946935336 2:224714430-224714452 CGGTGGTTTTCAATGGTGGATGG + Intergenic
1171253789 20:23670674-23670696 AGGCAAAGATCTATGGTGGATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG + Intronic
965744321 3:171907944-171907966 GGGTAAAGATCAAGGGTGAATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977337650 4:95718658-95718680 GGGTATAAAACAATGGTGGAAGG - Intergenic
979481849 4:121228480-121228502 CTGTAAATATCAATCCTGGTTGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990931849 5:61100627-61100649 AGGAAAATATTAATGGTGAATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992542833 5:77781430-77781452 CCCTAAATCTCAAAGGTGGATGG - Intronic
999546256 5:152631860-152631882 TGCTAAGTATCACTGGTGGATGG - Intergenic
1002558532 5:180063390-180063412 GTGTAAATAACAAGGGTGGATGG + Intronic
1004796805 6:19095403-19095425 GGGTAGATATGAATGGAGGAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1007168553 6:39846246-39846268 TGCTAAAAATCAATGGTGGTTGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1011288410 6:85749667-85749689 CTGTAACTATTACTGGTGGAAGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012249855 6:96968196-96968218 CAGTGATTCTCAATGGTGGATGG + Intronic
1012263408 6:97113401-97113423 CAGGAAATGTCAATGGTGGGAGG - Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG + Intronic
1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034724633 7:153324176-153324198 CCGTAAAAATATATGGTGGATGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1048549038 8:135416577-135416599 CGGTAATGGTCAATGGTGAATGG + Intergenic
1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG + Intronic
1051606991 9:18926163-18926185 GGGGAAATATCAATGGGGGAAGG + Intergenic
1052279691 9:26718887-26718909 AGGTAAATATGAATGTTGGGGGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055988845 9:82083506-82083528 TGGTAAATATAAATGGGTGATGG + Intergenic
1058351023 9:104024157-104024179 CTGTAAATTTGAATTGTGGAAGG - Intergenic
1061137283 9:128742165-128742187 TGATAAATATCACTGGTGAAAGG - Intronic
1186304451 X:8240647-8240669 CTTTAAATTTCAATGGTGCAAGG - Intergenic
1187735922 X:22303604-22303626 CTGTAAATCTGAATGGTGGTCGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195994097 X:110713950-110713972 TGGAAATGATCAATGGTGGAGGG + Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic