ID: 1023734746

View in Genome Browser
Species Human (GRCh38)
Location 7:43224873-43224895
Sequence CAGGAGGGACGTGGGTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023734739_1023734746 11 Left 1023734739 7:43224839-43224861 CCACGTAGGAAGTGTCTCTGGGA 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1023734746 7:43224873-43224895 CAGGAGGGACGTGGGTGTAGTGG No data
1023734737_1023734746 12 Left 1023734737 7:43224838-43224860 CCCACGTAGGAAGTGTCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1023734746 7:43224873-43224895 CAGGAGGGACGTGGGTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023734746 Original CRISPR CAGGAGGGACGTGGGTGTAG TGG Intronic
No off target data available for this crispr