ID: 1023735516

View in Genome Browser
Species Human (GRCh38)
Location 7:43232614-43232636
Sequence ATGATGTTCTTGCGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023735512_1023735516 -6 Left 1023735512 7:43232597-43232619 CCAATCTAGAACTGAACATGATG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG No data
1023735511_1023735516 -5 Left 1023735511 7:43232596-43232618 CCCAATCTAGAACTGAACATGAT 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023735516 Original CRISPR ATGATGTTCTTGCGGGAAAA GGG Intronic
No off target data available for this crispr