ID: 1023736580

View in Genome Browser
Species Human (GRCh38)
Location 7:43240965-43240987
Sequence TGGCCACTTGAGTCCAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023736572_1023736580 16 Left 1023736572 7:43240926-43240948 CCTGTGCCGAGCACTCCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG No data
1023736577_1023736580 1 Left 1023736577 7:43240941-43240963 CCTAGAGGATTTTCCTGAGGGTC 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG No data
1023736571_1023736580 17 Left 1023736571 7:43240925-43240947 CCCTGTGCCGAGCACTCCTAGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG No data
1023736570_1023736580 24 Left 1023736570 7:43240918-43240940 CCTGCTGCCCTGTGCCGAGCACT 0: 1
1: 1
2: 0
3: 32
4: 246
Right 1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG No data
1023736574_1023736580 10 Left 1023736574 7:43240932-43240954 CCGAGCACTCCTAGAGGATTTTC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023736580 Original CRISPR TGGCCACTTGAGTCCAACAG AGG Intronic
No off target data available for this crispr