ID: 1023736697

View in Genome Browser
Species Human (GRCh38)
Location 7:43241914-43241936
Sequence TGGGGGGTGTGGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1408
Summary {0: 1, 1: 0, 2: 7, 3: 114, 4: 1286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023736677_1023736697 26 Left 1023736677 7:43241865-43241887 CCCAGGCCTCTGTCATGGGGGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG 0: 1
1: 0
2: 7
3: 114
4: 1286
1023736678_1023736697 25 Left 1023736678 7:43241866-43241888 CCAGGCCTCTGTCATGGGGGAAG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG 0: 1
1: 0
2: 7
3: 114
4: 1286
1023736682_1023736697 20 Left 1023736682 7:43241871-43241893 CCTCTGTCATGGGGGAAGGGGAA 0: 1
1: 0
2: 2
3: 27
4: 362
Right 1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG 0: 1
1: 0
2: 7
3: 114
4: 1286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023736697 Original CRISPR TGGGGGGTGTGGAGGAAGAA GGG Intronic
900269761 1:1781062-1781084 TGGGGAGGGTGGAGGGAGAAGGG + Intergenic
900402857 1:2479710-2479732 TGCGGGGTGGGGAGGGAGCACGG - Intronic
900418640 1:2546234-2546256 TGGGGGGTGTGGGGGGTGAGGGG + Intergenic
900428093 1:2589614-2589636 CGGGGGCTGTGGAGGATGCAGGG - Exonic
900524507 1:3121845-3121867 GGCGGGAAGTGGAGGAAGAAGGG + Intronic
900612210 1:3548987-3549009 TGGGGGCTTTGGGGGAACAAGGG - Intronic
900624528 1:3602205-3602227 AGGGGTGTGTGGAGGAGGAGGGG - Intronic
900718895 1:4162321-4162343 TGGGGTGTGTGGAAGACGGACGG + Intergenic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900950263 1:5854655-5854677 TGGGGGCTGTTAGGGAAGAAGGG - Intergenic
901010490 1:6199212-6199234 TGGAGGGCGGGGAAGAAGAACGG - Intronic
901192284 1:7419830-7419852 TGGGGGGTGGAGAGGAAGAATGG - Intronic
901199002 1:7456195-7456217 TGGGAGGGAGGGAGGAAGAATGG + Intronic
901403980 1:9033824-9033846 AGGGGGTTGGGGAGGAGGAAGGG - Intergenic
901436694 1:9250963-9250985 GAGGGGGTGGGGAGGAGGAAAGG + Intronic
901806352 1:11741068-11741090 TGAGGGGAGTGGAGGAGGGAGGG - Intronic
901928959 1:12584468-12584490 GGGGGGGTGAGGAGGCAGAAAGG - Intronic
902077627 1:13800498-13800520 GGGGAGATGTGGAGGAAGAGGGG + Intronic
902426849 1:16330400-16330422 TGGGGGCTGGGGTGGAAGGATGG + Intronic
902585250 1:17435106-17435128 TGGGGGGTGCGGAAGAAGTCTGG + Intronic
902625715 1:17675174-17675196 TGGGCGGTGTTGGGCAAGAAAGG - Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902786301 1:18734733-18734755 TCGGGGGAGAGGAGGAGGAAGGG - Intronic
902805952 1:18861510-18861532 TGGGGGGTGTGGAGCAGGCTTGG + Intronic
902822186 1:18950208-18950230 TGTTGGGGGTGGAGGGAGAACGG - Intronic
902970240 1:20043132-20043154 TGAGGGGTGTAGGGGAATAATGG + Intronic
903332550 1:22603382-22603404 GGTGGGGTGGGGAGGAAGACAGG - Exonic
903336818 1:22629981-22630003 TGGGTGGTGGGGACAAAGAATGG + Intergenic
903570991 1:24304796-24304818 TGGGGGGTGTGGAGGTGTAGGGG + Intergenic
903577143 1:24346089-24346111 TGGGGGCTTTGGAGTAAGACAGG - Intronic
903878533 1:26492790-26492812 TGGGGGGTGTGGTGGGAGACAGG + Intergenic
903934529 1:26886043-26886065 TGGCGGTAGTGGCGGAAGAAAGG + Exonic
903966801 1:27095850-27095872 TGGGGAGTGTGGATGTGGAAGGG - Intergenic
904244968 1:29181440-29181462 TGGGGGTGGTGGAGGCATAATGG - Intronic
904883599 1:33719063-33719085 AGTGGGGCATGGAGGAAGAATGG + Intronic
905064508 1:35168777-35168799 TGGAGGGTGAGAAGGAAGATTGG + Intergenic
905199738 1:36307529-36307551 TGGTGGCTGGGGAAGAAGAACGG + Exonic
905259266 1:36706104-36706126 TTGGGGGAATGGAGGAAGAGTGG - Intergenic
905300409 1:36982814-36982836 TGGGGGTGGTGGGGGAAGGAGGG + Intronic
905307626 1:37030520-37030542 TGGGGGGTGGGGAAAAGGAAGGG - Intronic
905414497 1:37794775-37794797 TGGGGTGTGGGAAGGAGGAAGGG - Intronic
905459909 1:38115849-38115871 TGAGGGGTGGGCAGGGAGAATGG - Intergenic
906090695 1:43176973-43176995 CGGGGGGTGAGGAGCAAGAGGGG + Intronic
906210320 1:44009322-44009344 TGGGGGCTGAGGCGGGAGAATGG - Intronic
906248745 1:44295184-44295206 TGGGGGAAAAGGAGGAAGAATGG + Intronic
906295948 1:44649262-44649284 TGAGGGGCCTGGAGGCAGAAAGG + Intronic
906366799 1:45217048-45217070 GGGTGGGTGTATAGGAAGAAAGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906785304 1:48610426-48610448 TGGGGGGCATTGAGGAAGTAGGG + Intronic
907692106 1:56679435-56679457 TGGAGGGTGTGGTGGGAGAGTGG + Intronic
907776112 1:57516991-57517013 TTGAGGATGTGGAGGAGGAAGGG + Intronic
908023729 1:59926439-59926461 TGGGTGGGGTGGGGGATGAAGGG - Intronic
909054690 1:70807163-70807185 TTGGGGGGGTCGAGGAAGCAGGG + Intergenic
909602529 1:77475287-77475309 AGGGAGGTGGGGAGGTAGAAGGG + Intronic
909928466 1:81466983-81467005 GGGCTGGTGTGAAGGAAGAAAGG - Intronic
910229068 1:84967824-84967846 TGGAGGGAGGGAAGGAAGAAGGG + Intronic
910447243 1:87310947-87310969 TGGGGGGTGGGGAATAATAATGG + Intergenic
910682926 1:89885829-89885851 TGCAGGCTGTGGAGGCAGAATGG + Intronic
911410763 1:97503638-97503660 TGGAGGGTGTTGAGGAGGACTGG - Intronic
912432279 1:109635000-109635022 GGGGGGGTGAGGGGGAAGGAGGG + Intergenic
912452424 1:109775492-109775514 GGGAGGGTGTGGGGGAATAAGGG - Intergenic
912471494 1:109910271-109910293 TGGGGGCTGCAGAGGAAGAAGGG + Intronic
912489497 1:110054128-110054150 TGGGGGAAGTAAAGGAAGAATGG - Exonic
912503863 1:110142123-110142145 TGGGGGAGGTGGAGGAGAAATGG - Intergenic
912551818 1:110489823-110489845 CGGGGGTGGAGGAGGAAGAAGGG - Intergenic
912685172 1:111756251-111756273 CGGGGGGTGGGGTGGGAGAAGGG + Intronic
912697554 1:111852870-111852892 TCGGGGAAGTGGAGGAAGCACGG - Intronic
912759533 1:112354734-112354756 TGAGGGGCATGGAGAAAGAAGGG - Intergenic
912762536 1:112381997-112382019 TGGTGGGTGAGGGGAAAGAAGGG + Intergenic
912998784 1:114559054-114559076 TGTAAAGTGTGGAGGAAGAAGGG + Intergenic
913313019 1:117522018-117522040 TGGGGAGTTTGGGGGAAGAGTGG + Intronic
913476553 1:119243966-119243988 TGGGAGGTGAGGCGGGAGAATGG + Intergenic
913480697 1:119286446-119286468 TGCAGGGTGTGAAGTAAGAAAGG - Intergenic
913495446 1:119424083-119424105 GGAGGGGTGGGGTGGAAGAAGGG + Intergenic
914827784 1:151147579-151147601 TGAAGGGTGGGGAGGGAGAAGGG - Intergenic
914874622 1:151503625-151503647 TTGGGTGTGTGGAGGAAAACTGG + Intergenic
915135625 1:153729009-153729031 TGGGGGGTGTTGGTGAAGGAAGG + Intronic
915297365 1:154930670-154930692 TGGGGGGATGGGAGGAAGGAAGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915360377 1:155282874-155282896 TGGGGGATGTTGGGGGAGAAGGG + Intronic
915510868 1:156386336-156386358 GGGGGGCTGTGGAGGAAGGAGGG - Intergenic
915556174 1:156661996-156662018 TTGGGGGTGTGGGGGAGGAATGG - Intergenic
915644596 1:157259904-157259926 TGGGGTGTGGGGAGGAGGGAGGG + Intergenic
915671044 1:157489313-157489335 TGGAGGCTGAGGAGGGAGAATGG + Intergenic
916107423 1:161441766-161441788 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916109008 1:161449184-161449206 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916110595 1:161456565-161456587 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916112181 1:161463975-161463997 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916113768 1:161471356-161471378 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916372600 1:164116471-164116493 TGGGGTGTGGGGAGGGAGGAGGG - Intergenic
916500962 1:165386390-165386412 TGGGGGGTGTCAAGGACTAAGGG - Intergenic
916507223 1:165439264-165439286 GGGCGGGGGTGGAGGAAGATGGG + Intronic
916654257 1:166859504-166859526 TGGGGGAAGTGGAGGACAAAAGG + Intronic
917177816 1:172257845-172257867 TGGGGAGAGAGGATGAAGAAAGG - Intronic
917559928 1:176139801-176139823 TGGGGTGGGGGAAGGAAGAAAGG + Intronic
918014446 1:180619443-180619465 TGAAGGTTGTGCAGGAAGAAAGG + Intergenic
918181043 1:182086296-182086318 TGGGGAGGCTGCAGGAAGAAGGG - Intergenic
918319169 1:183348535-183348557 TTGGGGGTGTGGGGGAATGATGG + Intronic
918538656 1:185603574-185603596 TCAGGGGTGGGGAGGAAGAAAGG + Intergenic
919055586 1:192565798-192565820 TGGGGGGAGGGAAGGAAGGAAGG + Intergenic
919161750 1:193839488-193839510 TGGAGAGTATGGAGAAAGAAGGG - Intergenic
919481702 1:198098032-198098054 TGGGGAGGGTAGAGCAAGAAAGG - Intergenic
919551935 1:199001266-199001288 AGGGAAATGTGGAGGAAGAAAGG + Intergenic
919842252 1:201618180-201618202 TGGGGATTGAGGAGGAAGACTGG - Intergenic
919986072 1:202676167-202676189 TGGGGGGAAGGGAGGAAGATGGG - Intronic
920032015 1:203043281-203043303 TGGGGGAGGTGGTGGAAGTAAGG + Intronic
920043711 1:203120363-203120385 TGATGGGTGGGGAGGAATAAGGG + Intronic
920136113 1:203770685-203770707 GGTGGGGTGTGGTGGAAGAGAGG - Intronic
920279258 1:204830372-204830394 TGGGGGCAGTGGAGGAAGGCAGG + Intronic
920370005 1:205472951-205472973 TGAGGTGAGTGGAGGAAGGAGGG + Intergenic
920446478 1:206022299-206022321 TGGGTGGTGGGGAGGGACAAGGG + Intronic
920491609 1:206419970-206419992 TGGCTGGGGTGGAGGAGGAAGGG - Intronic
920647973 1:207817120-207817142 TGGGGTGTGTGGGAGAAGAATGG + Intergenic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
921065118 1:211617080-211617102 TGTGTGGTGAGGTGGAAGAAGGG + Intergenic
921197161 1:212769148-212769170 TGGGTGTTGTAGAGGGAGAAGGG + Intronic
921396427 1:214673521-214673543 AGGGAGGTGTGGAGGGAGAGGGG - Intergenic
921983719 1:221286029-221286051 AGGGAGGTGTGGAGGGAGAGGGG - Intergenic
922220855 1:223557505-223557527 TGGTGGGTGTGGCGGATGATGGG - Intronic
922319290 1:224471381-224471403 GGGGGAGTGGGGAGGAAGAGGGG - Intronic
922350217 1:224729069-224729091 AGGGGAGGGTGGAGGAACAAGGG + Intronic
922501589 1:226100811-226100833 GCTGGGCTGTGGAGGAAGAACGG + Intergenic
922517084 1:226215479-226215501 TGTGGGGTGTGTAGGAACTAGGG + Intergenic
922594450 1:226803214-226803236 ACGGGGGTCTGGAGGAAGAAGGG - Intergenic
922770963 1:228182698-228182720 TGGGGTGTGTGGGGGAGGACGGG + Intergenic
923022066 1:230172660-230172682 TCAGGGGAGTGGAGGAGGAAAGG - Intronic
923025012 1:230197096-230197118 GGTGGAGTGTGGAGGAAGAGAGG - Intronic
923039017 1:230306394-230306416 TGGTGGGGGTGGAGGAGGGAAGG + Intergenic
923186114 1:231575139-231575161 GGGAGGGTGGGGAGGAGGAATGG - Intronic
923298068 1:232614080-232614102 TGGGGATTTTGGAGGAAAAAGGG - Intergenic
923472959 1:234308605-234308627 TGGGGGTTGTGGGAGAAGGACGG - Intronic
923472975 1:234308656-234308678 TGGGGGTTGTGGGAGAAGGACGG - Intronic
923472991 1:234308707-234308729 TGGGGGTTGTGGGAGAAGGACGG - Intronic
924029240 1:239869643-239869665 TGGGGGGGTCAGAGGAAGAAAGG - Intronic
924049425 1:240065403-240065425 TGGGCAGAGTGAAGGAAGAAAGG + Intronic
924643583 1:245856822-245856844 TTGGGGGCCTGGAGAAAGAAGGG + Intronic
924945277 1:248842371-248842393 TGGGGAGTGTGGAGAAGGTATGG + Intronic
1063299123 10:4835922-4835944 TGGGGTTTGTGGAGCAAAAAAGG + Intronic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063369835 10:5514053-5514075 AGGGGGATGGGGAGGAAGAATGG - Intergenic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063613492 10:7582849-7582871 TGGGGGGTGGGGCAGAAGTAGGG + Intronic
1063730392 10:8690097-8690119 TGGGGTGTGGGGAGGAGGGAGGG - Intergenic
1063912249 10:10842930-10842952 TTTGGGAGGTGGAGGAAGAAAGG + Intergenic
1064165309 10:12980538-12980560 AGGAGGGGGTGGAGGAAGAAAGG + Intronic
1064409651 10:15093699-15093721 TAGGGGGTGCGGAGAAAGAAGGG - Intergenic
1064482260 10:15751404-15751426 TGGGAGGAGTCGGGGAAGAAGGG - Intergenic
1064526371 10:16260590-16260612 TGGAGGGAGGGAAGGAAGAAAGG + Intergenic
1064526403 10:16260716-16260738 TGGAGGGTGGGAAGGAGGAAAGG + Intergenic
1064618234 10:17185905-17185927 TGGGGTGCGGGGAGGAAGGAGGG + Intronic
1064652106 10:17519672-17519694 AGGGAGGGATGGAGGAAGAAAGG + Intergenic
1064777987 10:18801062-18801084 TGGGGGCTGTTGAGGAGGGAGGG + Intergenic
1064821495 10:19339913-19339935 TGGAAGGTGTAGAGGAAGCAAGG + Intronic
1064904257 10:20328690-20328712 TGGGGGCAAGGGAGGAAGAAAGG - Intergenic
1064966359 10:21019020-21019042 TGGGGGGAGGGGTGGGAGAACGG - Intronic
1065872910 10:29971370-29971392 TGCAGGGTGTGCAGGAAGCATGG + Intergenic
1066446768 10:35491034-35491056 TGGGGTGTGTGGAGGAGGGTGGG + Intronic
1066552783 10:36577947-36577969 TGTGGGGTGTGGAGGTATATAGG - Intergenic
1067103833 10:43351652-43351674 TGGGGGGTGTGGAGGGGGCCTGG - Intergenic
1067180641 10:43983384-43983406 TGGGGGGTGAGAGGGAAGAGAGG + Intergenic
1067213536 10:44281623-44281645 TGCCGGGTGGAGAGGAAGAAGGG - Intergenic
1067258579 10:44666560-44666582 TGGGGGGTGGGGAGGGGGAGTGG + Intergenic
1067299013 10:44992694-44992716 TGGGGTGTGTGGGGAAAGGATGG + Intronic
1067338696 10:45383967-45383989 TGAAGGGTCTGCAGGAAGAAGGG - Intronic
1067691388 10:48504380-48504402 TGGGGTGTGTGGGTGAACAAGGG + Intronic
1068424738 10:56845458-56845480 TGAGAGCTGTGGAGGAAAAAGGG - Intergenic
1068912294 10:62391388-62391410 GGGAGGGGGTGGAGGAGGAAAGG - Intronic
1069159620 10:65078250-65078272 TGGGGTGGGGGGAGGAGGAAGGG - Intergenic
1069215384 10:65812428-65812450 AGGGAGGTGTGGAGGGAGAGGGG - Intergenic
1069242968 10:66165303-66165325 TGAAGGGGGTGGAGGAAGAGAGG + Intronic
1069385798 10:67882692-67882714 TGGGAGGAGTGTAGCAAGAAAGG + Intergenic
1069409748 10:68141060-68141082 TTGGGGGGGTGGTGGAGGAAGGG - Intronic
1069474526 10:68721191-68721213 GGGGCGGCGTGGAGGAAGAGGGG + Intronic
1069772357 10:70907824-70907846 TGGGGGAGGTGGAGGAAGGGAGG + Intergenic
1069874057 10:71550855-71550877 TGGGGTGGGTGGAGGAGGGAAGG + Intronic
1070209847 10:74305461-74305483 TGGGGGTAAGGGAGGAAGAAAGG - Intronic
1070223364 10:74474547-74474569 TGAGGGGAGGGGAGGGAGAAAGG - Intronic
1070286499 10:75087492-75087514 GGGTGGGGGTGGGGGAAGAATGG + Intergenic
1070349028 10:75574613-75574635 TGAGGGGAGGGGAAGAAGAAGGG - Intronic
1070365756 10:75735293-75735315 TGGGGGGTGTTGATGTATAATGG + Intronic
1070572996 10:77655634-77655656 TGGGTGTTGTGGAGGAGAAAGGG - Intergenic
1070654564 10:78262482-78262504 TGAAGGGTCTGGAGGAAGGAGGG + Intergenic
1070665261 10:78338142-78338164 CAGGGGTTGTGGAAGAAGAATGG - Intergenic
1070838496 10:79467050-79467072 TGGGGAGGGTGGAGGGATAATGG + Intergenic
1070907828 10:80089678-80089700 TGGGGGGGTTGGAAAAAGAATGG + Intronic
1071447433 10:85761798-85761820 TGGGGGGTGTGGGGGGAGCATGG - Intronic
1071505329 10:86228383-86228405 TGGGTGGTGTGGAGTGAGGATGG - Intronic
1071572361 10:86704682-86704704 TGGGGGCTGAGGCGGGAGAATGG - Intronic
1071862277 10:89686461-89686483 TGGGGAGTGGGGCAGAAGAATGG - Intergenic
1072223850 10:93349879-93349901 TGTGGAGTGTGGAGGAGAAAGGG - Exonic
1072448445 10:95519591-95519613 GGGGAGGAGTGGAGGAAGGAAGG + Intronic
1072691447 10:97574696-97574718 TGAGGGGTGAGGAGGAAGGAAGG + Intronic
1072897181 10:99376997-99377019 GGATGGGTGGGGAGGAAGAAGGG - Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073278909 10:102337271-102337293 GGGGGGCTGAGGTGGAAGAATGG + Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073597796 10:104817606-104817628 AGGAGGGAGAGGAGGAAGAAGGG - Intronic
1074710877 10:116176596-116176618 TGGGGGCTGTACAGGAAGCATGG - Intronic
1075031807 10:119029328-119029350 TGGGAGGTGAGGAGAAAGTAGGG - Intergenic
1075083807 10:119400826-119400848 TTGGGGATGGGGAGGAACAAAGG + Intronic
1075278692 10:121119700-121119722 TGTGGGGTGAGAGGGAAGAAGGG - Intergenic
1075395790 10:122126080-122126102 TGGGGAGTGTGAAGAAGGAAAGG - Intronic
1075688014 10:124377418-124377440 TGGGTGCTGTGCTGGAAGAAGGG - Intergenic
1076063473 10:127430587-127430609 TGGGGGGTGGGGCAGAAGATGGG - Intronic
1076318866 10:129564175-129564197 GTGGGGGAGTGGAAGAAGAAGGG - Intronic
1076498455 10:130915141-130915163 TGGGGTGTGAGGAGGCAGGACGG - Intergenic
1076911985 10:133394898-133394920 TGGGGGCCGAGGGGGAAGAAGGG + Intronic
1076985486 11:233120-233142 TTGGGGTTGTGAAAGAAGAATGG + Exonic
1077207174 11:1350215-1350237 TGGGGGAGGTGGAGGAGGCATGG - Intergenic
1077614077 11:3662478-3662500 TGGGGTGTGGTGAGGATGAATGG - Intronic
1077804410 11:5575737-5575759 TGAGGGGTGGAGTGGAAGAAGGG + Intronic
1077815576 11:5682933-5682955 AGGGAGGTGTGGAGGGAGAGGGG + Intronic
1078638002 11:13069679-13069701 CAGGGGGTGGGGAGGAAGAAAGG + Intergenic
1078704169 11:13723123-13723145 TGGAGGCTGAGGTGGAAGAATGG + Intronic
1078713793 11:13820150-13820172 TGGGGTGGGGGGAGGAAGGAGGG - Intergenic
1078901601 11:15647855-15647877 TGAGTGGTGGGGAGGAAGAATGG - Intergenic
1078937860 11:15967880-15967902 TGGGCGGGGTGGGGGCAGAAAGG - Exonic
1079031121 11:16987248-16987270 TGGGGGGTGTGGGGGATGGGAGG - Intronic
1079713595 11:23717341-23717363 TGGAGGGTGCGGAAGAAGATAGG + Intergenic
1079792964 11:24761937-24761959 GGGGGGGTGGGGGTGAAGAAAGG + Intronic
1079886046 11:25990469-25990491 TGGGGAGTGAGGAGGAATATGGG - Intergenic
1080248330 11:30204504-30204526 TGAAGGGTGTGCAGGATGAATGG - Intergenic
1080320105 11:30998315-30998337 TGGGGAGGGGGGAGGAAGTATGG + Intronic
1080505724 11:32911283-32911305 TGGGGGTGGTGGGGGAAGACGGG + Intronic
1080569879 11:33546178-33546200 TGTGGGGTGAGGAGGAAGGCAGG - Intronic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080811491 11:35708761-35708783 TGGGGTGTGGGGAGGAGGGAGGG + Intronic
1081208847 11:40307148-40307170 TGGGGGGTGAGGAGGTGGAGTGG - Intronic
1081278948 11:41184639-41184661 TGGAGGGTTTAGAGGAAGACAGG - Intronic
1081605896 11:44526819-44526841 TGGGGTGTGGGGAGCAATAAGGG + Intergenic
1081704086 11:45170565-45170587 TGTGGGGTGGGGAGTAGGAAGGG + Intronic
1081991798 11:47342039-47342061 CGGGGTGTGTGGCTGAAGAATGG - Exonic
1082960177 11:58912444-58912466 TAGGGAGTGTGGAGGAAGCAAGG - Intronic
1082975755 11:59070205-59070227 CAGGGAGTGTGGAGGAAGCAAGG - Intergenic
1083340256 11:61954840-61954862 TGGGAGATGTGTAGGAAGGAAGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084519983 11:69657165-69657187 TGGGGGCAGAGGATGAAGAATGG - Intronic
1084676704 11:70639693-70639715 TGGGGTGGGTGCAGGAAGGAGGG + Intronic
1084907421 11:72358803-72358825 TGGGGGGGGTGGAGGAGGGGTGG - Intronic
1085038004 11:73311067-73311089 TGGGGCGTGTGGTGGACGACAGG + Exonic
1085092979 11:73734547-73734569 TGGGAGTTGGGGAGGAGGAACGG + Intronic
1085200296 11:74697757-74697779 AGGAGGGAGAGGAGGAAGAAAGG + Intronic
1085392560 11:76189946-76189968 TGGGGGCTGTGAAGGAAGCCAGG + Intronic
1085430817 11:76445824-76445846 GGGGTGGGGAGGAGGAAGAAGGG - Intronic
1085449932 11:76625657-76625679 TGTGGGGTGGGGATGAAGCATGG + Intergenic
1085482359 11:76833224-76833246 TGGGGGATGTACAGGAAGCATGG - Intergenic
1085653545 11:78291131-78291153 TGGGGAGTGTGACAGAAGAAGGG + Intronic
1086334497 11:85786247-85786269 TGGGGGCTGTGGAGGCTGTAGGG + Intronic
1086640174 11:89144297-89144319 TGGGGGGCGGTGAGGAAAAAGGG + Intergenic
1087064160 11:94011725-94011747 TGGTAGGTGTGGAGGAACCAAGG + Intergenic
1087151799 11:94866637-94866659 TGGGGCGTGGGAGGGAAGAATGG + Intronic
1087151816 11:94866699-94866721 TGGGGCGTGGGAGGGAAGAATGG + Intronic
1087151835 11:94866761-94866783 TGGGGCGTGGGAGGGAAGAATGG + Intronic
1087524241 11:99287851-99287873 GGGAGGATGTGGAGGAATAAAGG + Intronic
1087762065 11:102111489-102111511 GGAGGGGTGGGGAGGAAGGAAGG + Intronic
1087843090 11:102940375-102940397 TGGCGAGTTTAGAGGAAGAAAGG - Intergenic
1087908897 11:103729910-103729932 GGGGAGGTGGAGAGGAAGAAGGG + Intergenic
1088912132 11:114199528-114199550 TTGGGGATGTGGAGGCAGCATGG + Intronic
1088918682 11:114246003-114246025 TGGGGGGCTTGGGGGATGAAAGG - Intronic
1088976239 11:114818654-114818676 TGGGCAGGGTGGAGGCAGAAAGG - Intergenic
1089054787 11:115576747-115576769 GGAGGGGTGGGGAGGAGGAAAGG + Intergenic
1089065353 11:115658548-115658570 TGGAAGGTGTGGAGGAATGAGGG - Intergenic
1089070460 11:115695929-115695951 TAGAGGGGGTGGAGGAAGAGAGG - Intergenic
1089084633 11:115806732-115806754 TGGGAGATGTGTAGGAAGAGGGG - Intergenic
1089454507 11:118618197-118618219 TGGGGGTTGGGGAGGGAAAATGG - Intronic
1089504356 11:118953631-118953653 GGGGGGGATTGGAGGGAGAAGGG + Intronic
1089781125 11:120874008-120874030 TGAGAGGTGTAGAGGAAGAAAGG - Intronic
1089929306 11:122293733-122293755 GGGGGAGTGAGGAGGAAGAGCGG - Intergenic
1090076116 11:123581030-123581052 TGCGGGGTGTGGAGGAGGTAGGG - Intronic
1090176973 11:124658829-124658851 TTGGGGGTTTGTAGGAGGAAAGG + Intronic
1090463838 11:126915288-126915310 TGCTGGGAGTGGGGGAAGAATGG - Intronic
1091025537 11:132137765-132137787 TCGGGGTTGGGGAGGAAGCAGGG - Intronic
1091084478 11:132707136-132707158 AAGGGGGTTTTGAGGAAGAAAGG + Intronic
1091155460 11:133367762-133367784 TTGTGAGTGTGGTGGAAGAAGGG - Intronic
1091294080 11:134460278-134460300 CTGGGGGTGGGGAGGAACAAAGG + Intergenic
1091397968 12:165590-165612 TGGGGCGAGTTGAGGGAGAAGGG + Intronic
1091459165 12:630865-630887 TGGCGCGGGAGGAGGAAGAAGGG + Intronic
1091459299 12:631755-631777 TATGGGGTGAGGAGCAAGAAAGG - Intronic
1091610514 12:2004102-2004124 TCGGGGGTTTGGGGGAAGGAAGG - Intronic
1091798353 12:3309796-3309818 GGAGAGGTGTGGAGGAAGGAGGG + Intergenic
1091818072 12:3454469-3454491 AGGGGGGTGTCTAGGAAGGAAGG + Intronic
1091835220 12:3581034-3581056 TGAGGGATGTGGTGGAGGAAGGG + Intronic
1091917917 12:4282529-4282551 TGGGTGCTGGGAAGGAAGAATGG + Intronic
1091937623 12:4445965-4445987 TGGGGAGTGTGGAGGGTGATGGG - Intergenic
1092181130 12:6447774-6447796 TGGGGTGTGGGGAGGGAGGAGGG - Intronic
1092213358 12:6662911-6662933 TGGAGGGTGCGGAGAAAGAGGGG - Intronic
1092954162 12:13534085-13534107 TGGTGGCAGTGGAGGAAAAAAGG - Intergenic
1093246630 12:16746096-16746118 TGGGGGTTGGGGAGGAGGTAGGG + Intergenic
1094041647 12:26125789-26125811 TGGGGGCTGGGAAGGGAGAAGGG + Intronic
1094115199 12:26903804-26903826 TCGGGGGGGTGGGGGAACAAGGG + Intergenic
1094626278 12:32127361-32127383 TGGGGGGTGGGGTGGAATCATGG - Intronic
1095368968 12:41443281-41443303 TGGGGAGTGGGGGAGAAGAAGGG + Intronic
1095540669 12:43305340-43305362 GGAGGGGAGGGGAGGAAGAAGGG + Intergenic
1096110036 12:49023118-49023140 GGTGGGGTGTGGAGGGAGATGGG + Intronic
1096124607 12:49110248-49110270 AGGGGCGTGTGGGGGAGGAACGG + Intronic
1096145818 12:49277818-49277840 TGGGGGCTGTGGAGCAGGAGTGG + Intergenic
1096439071 12:51623755-51623777 TGGGGTGGGGGGAGGAGGAAGGG - Intronic
1096653135 12:53071952-53071974 GGGAGGGTGGGGAGGAAGGAAGG + Intronic
1096747695 12:53739175-53739197 TGGGAGGTGGGCAGGAAGAGGGG + Intergenic
1097190981 12:57219590-57219612 AGGAGGGTGTGGAGGCAGGAGGG - Intronic
1097233833 12:57526947-57526969 TGAGGGTGGTGGAGGAAGCAAGG - Exonic
1097248855 12:57621426-57621448 AGGTGGGGGTGGAAGAAGAAAGG + Exonic
1097735839 12:63179813-63179835 TCTGGGGTGTGGAGGAACAGTGG - Intergenic
1098474074 12:70879102-70879124 TGGGGTGTGGGGAGGGGGAAGGG + Intronic
1098541697 12:71664206-71664228 TTGGGGGCGGGGAGAAAGAACGG + Exonic
1099239420 12:80121010-80121032 TAGGGTGTGTGGAGGGACAAAGG + Intergenic
1099561020 12:84174073-84174095 TGGAGGGGGTGGAGGCAGAAGGG + Intergenic
1099685229 12:85877631-85877653 AGGGTGGAGTGGAGGAGGAAGGG - Intronic
1100383006 12:94079182-94079204 TGGGGTGGGTGGGGAAAGAAAGG + Intergenic
1100543967 12:95583984-95584006 TGTGGGGTGAGGAGGTGGAAAGG + Intergenic
1100726736 12:97416880-97416902 TGGGGGGTGTGGGGGGAGGGGGG + Intergenic
1100807796 12:98305355-98305377 TGCAGGCTGTGCAGGAAGAATGG - Intergenic
1100927959 12:99571233-99571255 TAAGGGTTGTGGAGGAAGAATGG - Intronic
1101003001 12:100374995-100375017 TGGGAGATGGGGAGAAAGAAGGG - Intronic
1101045536 12:100801746-100801768 TGGGGGGTGGGGTGGAGGGAAGG + Intronic
1101580514 12:106037795-106037817 AGGGAGGTGAGGAGAAAGAAGGG - Intergenic
1101673624 12:106898485-106898507 TGGGGGGTGGGGTGGGGGAAGGG + Intergenic
1101811718 12:108113258-108113280 TGGTGGGTGTGGAGGTAGCCTGG + Intergenic
1101888724 12:108692152-108692174 TGGGAGGGGTGGAGGATGCAGGG - Intronic
1102181137 12:110913218-110913240 TGGGGTCTGTGGGGGAGGAAGGG - Intronic
1102335281 12:112073539-112073561 TGGAGGCTGAGGAGGGAGAATGG - Intronic
1102434638 12:112911293-112911315 TGGGGGGAGGAGAGAAAGAAGGG + Intronic
1102514305 12:113436124-113436146 TGGGGGGTTTGGGGGAGGACAGG - Intronic
1102573670 12:113842909-113842931 TGGGAGGTGTGGTGGGAGGAAGG + Intronic
1102923254 12:116808591-116808613 TGGGGGGTGTGGAGCCAGGCGGG - Intronic
1103073640 12:117965147-117965169 TGGTGAGTGTGAAGGAATAAAGG - Intronic
1103800121 12:123532705-123532727 GGGGGGGGGGGGATGAAGAAAGG + Intronic
1104536255 12:129620820-129620842 TGGGGGATGAGGAAGAGGAAGGG + Intronic
1106082434 13:26511455-26511477 TGGGGGTTTTAGAGGAAGCAAGG + Intergenic
1106182585 13:27381521-27381543 TGGGGTGTGGGGAGGAAGGAAGG + Intergenic
1106546820 13:30738024-30738046 TGGGGTATGAGGAAGAAGAAAGG - Intronic
1106751032 13:32768286-32768308 TGGGGTGGGAGGAAGAAGAAAGG + Intronic
1106775916 13:33009519-33009541 TGGGTGGGGTAGAGGAAGAAAGG - Intergenic
1106802171 13:33267432-33267454 TGGGGAGAGTGGAGGCACAATGG - Intronic
1106947023 13:34840105-34840127 GGGGGGGTGGGAAGGAAAAACGG + Intergenic
1107153302 13:37137765-37137787 TGGAGGGTGAGGAGGAATGAAGG - Intergenic
1107156177 13:37169467-37169489 TTGGGGGTGTGATGGTAGAAAGG - Intergenic
1107315640 13:39128527-39128549 TTGGGGGTAAGTAGGAAGAAAGG + Intergenic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1107401855 13:40077069-40077091 TGGAGGGAGGGAAGGAAGAAAGG + Intergenic
1108304070 13:49113261-49113283 TGGGGAAAGTGGAGGAAAAAAGG - Intronic
1109016738 13:57025400-57025422 TGGGGGATGTGGTGGAGGGAGGG - Intergenic
1109044964 13:57398980-57399002 TGGTGGGTGGGAATGAAGAATGG - Intergenic
1109707008 13:66108659-66108681 TGGGAGATGTGAATGAAGAAGGG - Intergenic
1109747429 13:66645261-66645283 TGGGTGATGGGGAGGAGGAAGGG - Intronic
1109810454 13:67507137-67507159 TGGAAGGTAGGGAGGAAGAAGGG - Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1110368824 13:74718378-74718400 AGGGAGGTGTGGAGGGAGAGGGG + Intergenic
1110386563 13:74918861-74918883 TTGGGAGTGGTGAGGAAGAAGGG + Intergenic
1110443540 13:75550617-75550639 TGGGGGTTGGGGAGGGAGGAGGG + Intronic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111047598 13:82835139-82835161 TGGGGGTTGTGGGAGAAGGAAGG + Intergenic
1111110851 13:83707496-83707518 TGGAGGCTGAGGAGGGAGAATGG - Intergenic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1111785938 13:92786827-92786849 TGTGGGGTAATGAGGAAGAAAGG + Intronic
1112743436 13:102500805-102500827 TGGGGGATGGGGAGGAAGCAAGG - Intergenic
1112829316 13:103429156-103429178 TGAGGTTTGGGGAGGAAGAAGGG - Intergenic
1113019402 13:105866348-105866370 GGGGGGGGGGGAAGGAAGAAAGG + Intergenic
1113040623 13:106100605-106100627 TGGGGGGTGGGGAGGCAGGAAGG + Intergenic
1113043037 13:106125273-106125295 TGGAGGGGAAGGAGGAAGAAGGG - Intergenic
1113380022 13:109795819-109795841 TGGGGGTAGGGGAGGAAGAGAGG + Intergenic
1113453744 13:110432373-110432395 TGGGGGGTGAGGATGAGGGAAGG + Intronic
1113454543 13:110438787-110438809 GGGGGGGTGGGGAGTAATAACGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113612034 13:111653826-111653848 TGGGGGTTCTGGAAGATGAAAGG - Intronic
1113654995 13:112062581-112062603 GGGGGTGTGTGGAAGGAGAACGG - Intergenic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1113796317 13:113060887-113060909 GGGCGGGGGTGGGGGAAGAAAGG - Intronic
1113796600 13:113061886-113061908 TAGGGGGAGAGGAGGAGGAAGGG - Intronic
1114155500 14:20099172-20099194 GGGGAGGTGTGGAGGGAGACGGG + Intergenic
1114216900 14:20663939-20663961 TGGGCGCTGGGGAGGAAGGAGGG - Intergenic
1114318198 14:21525840-21525862 AGGGGGGTGGGGAGGGAGGAGGG + Intronic
1114426336 14:22626807-22626829 AGGAGGGTGGGGACGAAGAAGGG - Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114790396 14:25651319-25651341 TGGAGGGTGAGGGGAAAGAAAGG - Intergenic
1115020149 14:28669992-28670014 AGGGAGGAGTGGAGGAAGGAAGG + Intergenic
1115096704 14:29646245-29646267 TGTGGGATGGGGAGGAAGGAGGG + Intronic
1115098596 14:29670684-29670706 TGGGTGATGGGGAGGGAGAATGG - Intronic
1115320621 14:32076693-32076715 TGGGAGAGGCGGAGGAAGAAGGG + Intronic
1115498289 14:34027457-34027479 AGGGAGGAGAGGAGGAAGAAGGG + Intronic
1115753449 14:36512874-36512896 TGGGGGGTGGGGAGCAGGGAAGG + Intronic
1115774485 14:36700245-36700267 TGGGGGATTTGTTGGAAGAAGGG - Intronic
1116235680 14:42276045-42276067 TGGGGTGGGTGGAGGAGGGAGGG + Intergenic
1116347401 14:43812359-43812381 TAGAGGCTGAGGAGGAAGAATGG - Intergenic
1116434803 14:44885022-44885044 GGGGGGGTGTGGATGAAGTGGGG + Intergenic
1116701696 14:48252832-48252854 TGGAGGGTTCAGAGGAAGAAAGG - Intergenic
1116953068 14:50896295-50896317 GGGGTGGTATGGAGGGAGAATGG - Intronic
1117018133 14:51539839-51539861 TGGGGGGAGTAGAGGAAGGTGGG + Intronic
1117029676 14:51655152-51655174 TTGGGGGTGGGGAGGAGGTAGGG - Intronic
1117297533 14:54393447-54393469 CGGGTGGTGTGGAGGGAGAGCGG + Intergenic
1117327843 14:54685263-54685285 GGGGGGGGGGGCAGGAAGAATGG - Intronic
1117536895 14:56711085-56711107 TTGGGGGCATGGATGAAGAAAGG - Intronic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118046596 14:61977193-61977215 TGGAGGGTTTGGAAGAAGACAGG - Intergenic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118477207 14:66128619-66128641 GGGAAGGAGTGGAGGAAGAAGGG - Intergenic
1118693436 14:68361582-68361604 TGGGGGGTAAGGATGGAGAAAGG + Intronic
1118869948 14:69733055-69733077 TGGGGTGTGTGGAGAGGGAAGGG + Intronic
1119144093 14:72294587-72294609 TGGAGGCTGTGCAGGAAGCATGG + Intronic
1119180391 14:72601063-72601085 AGGGGGAGGAGGAGGAAGAAGGG + Intergenic
1119184369 14:72629547-72629569 TGAGGGGTGAAGAGGAAGGAAGG - Intronic
1119399993 14:74356894-74356916 TGGGGAGAGTGAAGGAAGACAGG - Exonic
1120221100 14:81734539-81734561 TGAGGGGTGTGGAGAAAGATGGG + Intergenic
1120454126 14:84710043-84710065 TGGGAGGTATGGAAGAAGAAAGG - Intergenic
1120646272 14:87078295-87078317 TGGGGGCTGTGGTGGGAAAAAGG - Intergenic
1120864400 14:89283626-89283648 TGGCGGGTGAAGGGGAAGAATGG + Intronic
1120920146 14:89747411-89747433 TGATGGGTGTGGGGTAAGAAAGG - Intergenic
1121001873 14:90456840-90456862 TGTGGAGTGGGGAGGAAGAGGGG + Intergenic
1121427805 14:93865173-93865195 TGGGGAGAGTATAGGAAGAATGG - Intergenic
1122065763 14:99173515-99173537 TGGGGGGTGTGGATGTACAGCGG - Exonic
1122076285 14:99237068-99237090 TGGGGGGTGTAGAGGGGGAGTGG + Intronic
1122122597 14:99562340-99562362 TAGGGCTTGTGGAGGTAGAAGGG - Intronic
1122218939 14:100222901-100222923 TGGGGGGAGGGAAGGAAGGAAGG + Intergenic
1122244112 14:100389514-100389536 TGGGGGGAGTGGAGCAAGCCGGG + Intronic
1122270195 14:100565530-100565552 TGGGGGGTGTGGGAGAGGAGGGG + Intronic
1122787286 14:104169531-104169553 TGGGGGGTGTGCAGGGTGGAGGG - Intronic
1122915113 14:104854985-104855007 AGGGGGGAGTGGAGGGTGAATGG + Intergenic
1122985531 14:105209911-105209933 AGGGGGGTCTGGAGGAGGCAGGG + Exonic
1202901930 14_GL000194v1_random:49287-49309 TGGGGCTTGTGGAGAAAGACAGG + Intergenic
1123427304 15:20183255-20183277 TAGGAAGTGTAGAGGAAGAAAGG - Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123536541 15:21189805-21189827 TAGGAAGTGTAGAGGAAGAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124019376 15:25905238-25905260 TGGGTGCTGTGGAGGAAGGCGGG - Intergenic
1124051796 15:26203355-26203377 AGGGGTGTGTTGCGGAAGAAGGG - Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124343065 15:28902244-28902266 TGGGTGCTGTGGAGGGAGGAGGG + Intronic
1124352100 15:28963417-28963439 AGGTGGGTGGGGAGGATGAAAGG - Intronic
1124439169 15:29674722-29674744 GAGGGGGTGTGGAGGAGGGAAGG + Intergenic
1124622024 15:31279243-31279265 CAGGGGGTGTGAAGGAAGCAGGG - Intergenic
1124686224 15:31784893-31784915 GGGAAGGTGTGGAGGCAGAATGG + Intronic
1124991121 15:34674730-34674752 TGAGGGATGTGGGGGAAGCATGG + Intergenic
1125083583 15:35703739-35703761 TGGGGGGTTGGGAAGAAGATTGG + Intergenic
1125587090 15:40828605-40828627 TGGGAGATGTGCAGGAAGCAGGG + Exonic
1126104460 15:45138454-45138476 AGGGGGGTGGGGAGGAAGCAGGG + Intronic
1126629121 15:50715602-50715624 GGGTGGGGGTGGGGGAAGAATGG + Intronic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1126929889 15:53635687-53635709 TGGGGGGGATGGAGGGAGATGGG + Intronic
1127052151 15:55095770-55095792 TGCAGGCTGTAGAGGAAGAATGG + Intergenic
1127136229 15:55926765-55926787 TGGGGGGTGTGGTGGAGGGGAGG - Intronic
1127332267 15:57950809-57950831 TGGAGGGAGGGAAGGAAGAAGGG + Intergenic
1127625535 15:60776471-60776493 TGGGTGCTGGGGAGAAAGAAAGG + Intronic
1127673764 15:61220910-61220932 TGGGGGCTGTGGATGAAGGCAGG - Intronic
1127932738 15:63607825-63607847 TGGAGTGTGTGCAGGAAGAGGGG - Intergenic
1128370834 15:67038003-67038025 TGGGGTTGGGGGAGGAAGAAAGG - Intergenic
1128541552 15:68538237-68538259 TGGTGTGTGTGGAGGAAGAGGGG + Intergenic
1128542124 15:68543527-68543549 TGGGGTGGGAGGAGGAAGGAGGG - Intergenic
1129069345 15:72937882-72937904 TGGGAGGAGTGGAGGAGGCAAGG + Intergenic
1129108440 15:73324036-73324058 TGGGGGGTGTTGGGGGAGGAGGG - Intronic
1129161173 15:73748784-73748806 AGGGGAGTGTGGAGGAAGGCAGG - Intronic
1129332047 15:74832718-74832740 TGGGGAGGGGGAAGGAAGAAGGG - Intergenic
1129673942 15:77622295-77622317 TGGGGGGAGGGGAGAAAGATGGG + Intronic
1129776623 15:78241198-78241220 TGGGGGCAGGGGAGGAAGGACGG - Intronic
1129960859 15:79682528-79682550 TGGAGGGGTGGGAGGAAGAATGG + Intergenic
1130042878 15:80419497-80419519 TGGGTGATCTGGAGGGAGAAGGG + Intronic
1130110458 15:80959674-80959696 TGGGGGGATTGGAAGAAGAGGGG - Intronic
1130214854 15:81958688-81958710 GGGGTGGTTTGGAGGAAGGAGGG - Intergenic
1130430442 15:83842037-83842059 AGGGGGATGGGGAGGCAGAAGGG - Intronic
1130754423 15:86747619-86747641 TGGGGTGTGGGGAGGAGGGAGGG - Intronic
1130855996 15:87840725-87840747 GGGAGGGAGGGGAGGAAGAAAGG + Intergenic
1130961094 15:88659151-88659173 TGGGGAGTGTGGGGAGAGAAGGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131197090 15:90364314-90364336 GGGGGGGTGGGCAGGAAGACAGG - Intronic
1131229153 15:90647433-90647455 GGAGGGGTGTGGAGGAGGAGGGG - Intergenic
1131229168 15:90647476-90647498 GGAGGGGTGTGGAGGAGGAGGGG - Intergenic
1131229240 15:90647675-90647697 GGAGGGGTGTGGAGGAGGAGGGG - Intergenic
1131258071 15:90874354-90874376 TGGTGGGCGTGGAGCAAGCAAGG + Intronic
1131299726 15:91186715-91186737 TGGGGGGTGAGGAGGTTGAGGGG + Intronic
1131442321 15:92468302-92468324 GGGAGGGTGTAAAGGAAGAATGG - Exonic
1131529372 15:93178992-93179014 TGGGGGGCGTTGGGGAAGGAGGG + Intergenic
1132079740 15:98853810-98853832 TGCGGGGAGTGGAGGAGGAGGGG + Intronic
1132149969 15:99452337-99452359 TGAGGGATGATGAGGAAGAAGGG + Intergenic
1132497231 16:269613-269635 TGAGAGGTGAGGAGGCAGAAGGG - Intronic
1132599556 16:767706-767728 GGGGGGGCGTGGAGGAGGAGGGG + Intronic
1132668303 16:1091720-1091742 TGTGGGGGCTGGAGGAAGATTGG - Intronic
1132839719 16:1973057-1973079 TGGGAGGTGTGTGGGCAGAAGGG + Intronic
1133409961 16:5559902-5559924 TGGAGGGTGAGGAAGAATAAAGG - Intergenic
1133720354 16:8488942-8488964 TGGGGTGGGTGGAGGAGGAAGGG + Intergenic
1134019335 16:10910649-10910671 TGGGGAGAGGGGAGTAAGAAAGG + Intronic
1134040394 16:11063965-11063987 AGGAGGGATTGGAGGAAGAAAGG + Intronic
1134341769 16:13353086-13353108 TGGGTGGTATGGAGAGAGAATGG + Intergenic
1134408268 16:13981728-13981750 TGTGGGGTGTGGACAAAGCATGG + Intergenic
1134479282 16:14603539-14603561 TGTGGGTGGTGGAGGAGGAAGGG - Intronic
1134572557 16:15303830-15303852 TGGGGGGAGCGGAGGTAGAGAGG - Intergenic
1134599806 16:15524429-15524451 TGGGAGGTGGGGAGGAAGGTGGG + Intronic
1134610687 16:15605803-15605825 TGGGGTGTGAGCAGCAAGAATGG - Intronic
1134729825 16:16452192-16452214 TGGGGGGAGCGGAGGTAGAGAGG + Intergenic
1134856914 16:17527678-17527700 TGGGTTGTGTGGATGTAGAAGGG - Intergenic
1134937606 16:18259704-18259726 TGGGGGGAGCGGAGGTAGAGAGG - Intergenic
1135258527 16:20961345-20961367 TGGGGTGCGGGGAGGGAGAAAGG + Intronic
1135834095 16:25807299-25807321 TGGAGAGTGTTGGGGAAGAAGGG - Intronic
1135860509 16:26051751-26051773 TGTGGGGTGGGGAGGAAGGAGGG - Intronic
1135871162 16:26151860-26151882 TGGGGAGTGTGCAGGAACAATGG + Intergenic
1136063496 16:27743002-27743024 TGGGGGGTGTAGTGGGAGGAGGG - Intronic
1136226587 16:28864134-28864156 TGGGGGGTGTCCAGGGAGTAGGG + Intronic
1136366080 16:29809796-29809818 TGGGGGGTGTGGGGGACAACGGG + Intronic
1136539879 16:30923455-30923477 TGGAGGTGGTGGAGGAAGGAGGG + Intronic
1137531125 16:49279719-49279741 TGGGGGGTGGGGGGGGCGAATGG + Intronic
1137890343 16:52155005-52155027 TGTGGGGTGGGGAGGGAGAGGGG - Intergenic
1138070192 16:53985103-53985125 TGGGGGTTGGGGAGAGAGAAGGG + Intronic
1138215469 16:55201414-55201436 GGGAGGGAGGGGAGGAAGAAAGG - Intergenic
1138236124 16:55384248-55384270 GAGGGGGTGAGCAGGAAGAAGGG - Intergenic
1138311178 16:56025133-56025155 TGGGGAGTGTGGTGCATGAATGG - Intergenic
1138311242 16:56025546-56025568 TGGGGAGTGTGGTGGATGAATGG - Intergenic
1138311265 16:56025666-56025688 TGGGGAGTGTGGCGCATGAATGG - Intergenic
1138311320 16:56025936-56025958 TGGGGAGTGTGGTGCATGAATGG - Intergenic
1138509437 16:57499731-57499753 TGGGGAGTGTGGGGGGAGCAAGG - Intergenic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1138955140 16:61962351-61962373 TGGAGGGTGTGGGGGAAGTGGGG + Intronic
1139616463 16:68097179-68097201 TTGGAGGTGGGGAGGGAGAAAGG + Intronic
1140315621 16:73893793-73893815 TGGGGGCTGGGGAGGAGAAAGGG + Intergenic
1141466729 16:84210943-84210965 TGGGGAGTGTGGAGCCAGACAGG + Intergenic
1141514559 16:84535091-84535113 TGGGGGAGAAGGAGGAAGAAGGG - Intronic
1141613996 16:85199921-85199943 TGTGGGATGTGGAGGACGAGGGG + Intergenic
1141992320 16:87617626-87617648 TGGGGGCTGTGGAGGTAGGGGGG + Intronic
1142028044 16:87824849-87824871 AGGGAAGTGTGGAGGAAAAACGG - Intergenic
1142163112 16:88569712-88569734 TTGGGGATATGGAGGAAGATGGG + Intergenic
1142377308 16:89712524-89712546 TGGGGGGGGAGGAGGGAGTAAGG + Intronic
1142840653 17:2626546-2626568 GGGGGGGGGGGGGGGAAGAAAGG - Intronic
1143115006 17:4577166-4577188 TGGAGGGGGTGAGGGAAGAAGGG + Intergenic
1143132774 17:4690847-4690869 TGGGGGAGGAGGAGGAAGTAGGG + Intronic
1143362726 17:6384697-6384719 TGTGGGATGTGGAGGGAGGAAGG - Intergenic
1143447714 17:7018919-7018941 TGGGGGGTGTGTCGGAAGAGGGG - Intergenic
1143513255 17:7407175-7407197 GGGGGGTTCTGGAGGAAGACGGG - Intronic
1143580569 17:7823415-7823437 TGGGAGAAGGGGAGGAAGAAAGG - Intronic
1143617872 17:8064309-8064331 TGGGGAGGGGGGAGGCAGAAAGG + Intergenic
1144084322 17:11794924-11794946 TGGGGTGGGGGGAGGGAGAAGGG + Intronic
1144467112 17:15505683-15505705 AGGGAGGTGTGGAGGGAGAGGGG + Intronic
1144547892 17:16215114-16215136 TATGGAGTTTGGAGGAAGAATGG - Intronic
1144665112 17:17097049-17097071 TCTGGGGTGTGGAGCAGGAAGGG + Intronic
1144694329 17:17291646-17291668 TGGGGGATGTGGGGGATGAGAGG - Intergenic
1144737043 17:17561042-17561064 TGTGGGGTCTGGAGGAAGGGAGG - Intronic
1144807772 17:17979001-17979023 TATGTGGTGTGGAGGAAAAAAGG + Intronic
1145014614 17:19387984-19388006 TGAAGGGTTTGGAAGAAGAAAGG - Intergenic
1145404125 17:22570854-22570876 TGGGGAGTGGGAAGGAAGGAAGG + Intergenic
1145782154 17:27570485-27570507 TGGTGGGTGTGGAGGAATAGAGG - Intronic
1145804705 17:27718263-27718285 TGGGGTGTGGGGAGGGTGAAGGG - Intergenic
1145841712 17:28000587-28000609 TGGGGAAGGTGGAGGAAGAGAGG - Intergenic
1145852544 17:28115227-28115249 GGGTGGTGGTGGAGGAAGAAGGG - Intronic
1145955792 17:28853897-28853919 GAGGGGGTGTTGAGGAAGGAAGG - Intronic
1146113584 17:30114082-30114104 TGGGGGATTTGGAGGAAAATAGG + Intergenic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1146422616 17:32702562-32702584 TGGGGGGCGAGGAGGGACAAAGG - Intronic
1146688480 17:34857107-34857129 AGGGGGGTGGGGAGGAACGAGGG + Intergenic
1146968872 17:37056103-37056125 TGGGGAGTGTGGAAGAAGCTTGG + Intronic
1147168443 17:38605260-38605282 TGGGGGAAGTGGAGGATGCAGGG - Intronic
1147178562 17:38671553-38671575 TGTGGGAGGAGGAGGAAGAAGGG - Intergenic
1147186093 17:38713764-38713786 TGGGGCGAGTGGAGGAGGATGGG - Intronic
1147191208 17:38739164-38739186 TGGGGTCAGTGGAGGAGGAATGG + Intronic
1147191322 17:38739684-38739706 TTGGGGGTGTGGAGAGAGAGAGG + Intronic
1147309871 17:39589159-39589181 TTGGGGGTGTGGAGGAAAATGGG - Intergenic
1147568178 17:41550425-41550447 TGGGAGGTGGGGATGAAGGAGGG + Intergenic
1147743060 17:42679585-42679607 TGGGAGCTGAGCAGGAAGAAAGG + Exonic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148525666 17:48330761-48330783 TTGGGGGTGTGGGTGAAGAGTGG + Intronic
1148637267 17:49158386-49158408 AGGAAGGTGTGGAGTAAGAAGGG + Intronic
1148804276 17:50256438-50256460 TGGGGAGGGTGGAGTAAGCAGGG - Intergenic
1148829603 17:50422756-50422778 TTGGGGGTGTGGTGGGGGAATGG - Intergenic
1149114112 17:53070999-53071021 TGGGGGGTGTGGAAGGGGAGTGG + Intergenic
1149457099 17:56797029-56797051 TGGGAGGAGTGGGGGAAGGAGGG - Intronic
1149518110 17:57295676-57295698 TGAGGGGCTTGGAGGGAGAAAGG + Intronic
1149536632 17:57438409-57438431 AGGAGGGGATGGAGGAAGAAGGG - Intronic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1149997250 17:61411749-61411771 GCGGGGGAGTGGAGGAGGAAGGG - Exonic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1151025519 17:70672068-70672090 TGGGGGGCGGGGAAGGAGAAAGG - Intergenic
1151043366 17:70890661-70890683 TGAGGGGTGAAGAGGAAGAGCGG + Intergenic
1151193697 17:72416625-72416647 AGGGGGGTGCGGGGGAAGAGGGG + Intergenic
1151363846 17:73604648-73604670 TGAGGGGTGTGGAGAGAGAAAGG + Intronic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1151375301 17:73684420-73684442 TGGGAGGTGAGGAAAAAGAAAGG + Intergenic
1151508097 17:74542409-74542431 TCTGGGGTCTGGAGGAAGAAGGG - Intronic
1151619075 17:75234154-75234176 AGGAGGCTGAGGAGGAAGAATGG - Intronic
1151713123 17:75817946-75817968 TAGGGGGTGGGGAGGAAGAAGGG + Intronic
1151848949 17:76678316-76678338 GGATGGGTGTGGAGGAAGACTGG + Intronic
1151886392 17:76925482-76925504 AGGGTGGGGTGGAGGAAGAGAGG - Intronic
1152033543 17:77858208-77858230 TGGGAGGGGTGATGGAAGAATGG - Intergenic
1152210664 17:79001447-79001469 TGTGGGGTCTGGAGGTAAAATGG - Intronic
1152315944 17:79580259-79580281 TGGGGGGGGAGGAGGAGGACGGG - Intergenic
1152541277 17:80977502-80977524 TGGGGGGAGAGGAGGAATGAGGG + Intergenic
1152577991 17:81151321-81151343 TGGGGGATGTGGGGGAGGAGGGG - Intronic
1152610649 17:81313688-81313710 TGCGGGGTGGTGAGGATGAAGGG - Exonic
1152733244 17:81983746-81983768 TGGGGGGTGCTGGGGAAGGAGGG + Intronic
1152878885 17:82804148-82804170 TGTGGGGTGTTGGGGAAGAGTGG + Intronic
1153352602 18:4097513-4097535 TGAGGTGTCTGGAGGCAGAAGGG - Intronic
1154031329 18:10756504-10756526 TGGAGGATGAGGAGGAAGGAAGG + Intronic
1154031523 18:10757427-10757449 TGGAGGGTGAGGAGGAAGGGTGG + Intronic
1154165067 18:12008648-12008670 TGGGTGGGGTGCAGGAGGAAGGG + Intronic
1154315555 18:13300843-13300865 TGGGGTGTGGGAAGGAAGGAAGG + Intronic
1154343207 18:13521599-13521621 AGTGGCGTGAGGAGGAAGAAGGG + Intronic
1155492686 18:26415835-26415857 TGGGTGGAGGGGAGGAAGAGTGG - Intergenic
1156264792 18:35477760-35477782 TGGGGAGTGGGGAGGAAGATAGG + Intronic
1156276272 18:35585628-35585650 AGGAGGGGGTGGAGGTAGAAGGG - Intronic
1156291929 18:35755055-35755077 TGTGTGGAGTGGAGGGAGAAGGG - Intergenic
1157283030 18:46358595-46358617 TGGTGGCTGTGGAGAAAGGAGGG + Intronic
1157558267 18:48627774-48627796 GGGAGGGTGGGGAGGAAGGAAGG + Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1158793924 18:60818415-60818437 TGGGGTGGGGGGAGGGAGAAGGG - Intergenic
1158848514 18:61470183-61470205 TGGGGGGTGTGGAGAAATCAGGG + Intronic
1159465906 18:68784188-68784210 TGTGGGCTGTGCAGGAAGCATGG + Intronic
1159543816 18:69814654-69814676 TGGAAGGTGAGGAGGAAGCAAGG + Intronic
1159906518 18:74097394-74097416 TGGGGGGTTGGGAGGATGAGGGG + Intronic
1160037306 18:75313725-75313747 GGGGAGGTGAGGAGGAAGAGAGG + Intergenic
1160313675 18:77820993-77821015 TGGGGGGAGTGGGGGAAACACGG + Intergenic
1160564018 18:79775848-79775870 TGGGGAGTGCGCAGGGAGAACGG - Intergenic
1160629721 18:80238341-80238363 TGGGGTGTGGGGAGGGAGTAGGG + Intronic
1160679009 19:404625-404647 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160679068 19:404755-404777 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160679083 19:404788-404810 TGAGGGGTGTGGAGGGGGGACGG + Intergenic
1160679173 19:404982-405004 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160739396 19:679086-679108 AGGGGGGTCTGGAGGGAGCAGGG - Intronic
1160925134 19:1540695-1540717 TGGGGTGGGGGGAGGAAGCAGGG + Intergenic
1161139669 19:2639916-2639938 AGGAGGGAGTGAAGGAAGAAAGG + Intronic
1161392492 19:4028638-4028660 TGGGGGGCGTGGAGGGAGGGTGG + Intronic
1161404590 19:4084375-4084397 TGGGAGGGAGGGAGGAAGAAGGG - Intergenic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1162049280 19:8022767-8022789 TGGGGGGTGAGGCAGGAGAATGG - Intronic
1162752809 19:12838933-12838955 TGGTGGGGGTAGAGGAAGAAGGG + Intronic
1162781614 19:13009868-13009890 TGGGGGATTTGGTGGTAGAACGG + Intronic
1162818768 19:13210554-13210576 GGGGGGGTGGGGAGGAAGAGGGG + Intronic
1162937581 19:13989069-13989091 AGGGAGGTGTGGAGTCAGAAAGG + Intronic
1163092262 19:15028745-15028767 TGGGGGATGCGGAGGAGGAAAGG - Intergenic
1163226757 19:15967283-15967305 AGGGAGGGGCGGAGGAAGAAAGG + Intergenic
1163376638 19:16937099-16937121 TGGAGGGAGGGAAGGAAGAAAGG - Intronic
1163454631 19:17399277-17399299 TGGGGGTTGTGGGGGGAGAGTGG + Intergenic
1163720835 19:18897437-18897459 TGTGGGGTGAGGAGGAAGCCAGG - Intergenic
1163730194 19:18944552-18944574 TGGGGGGGAGGGAGGAAGGAAGG + Intergenic
1163893943 19:20040781-20040803 CGGGGGGTGTGGAGAATGACTGG + Intergenic
1164492353 19:28727134-28727156 TGAGGAGTGAGGAGGCAGAAAGG + Intergenic
1164591948 19:29512213-29512235 GGGGGGATGAGGAGGAAGTAGGG + Intergenic
1164592051 19:29512584-29512606 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592278 19:29513442-29513464 GGGGGCATGAGGAGGAAGAAGGG + Intergenic
1164592304 19:29513526-29513548 AGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592358 19:29513709-29513731 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592366 19:29513729-29513751 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592374 19:29513749-29513771 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592382 19:29513769-29513791 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592547 19:29514328-29514350 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592565 19:29514368-29514390 GGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592581 19:29514410-29514432 TGGGGGATGAGGGGGAAGGAGGG + Intergenic
1164700544 19:30281217-30281239 TGGGGAGCGAGGAGGGAGAAAGG - Intronic
1164937028 19:32223040-32223062 GGGAGGGTGGGAAGGAAGAAGGG + Intergenic
1165434530 19:35788756-35788778 TGGGGCATGTGGGGAAAGAAGGG - Exonic
1165728119 19:38126249-38126271 AGGGGGGTGTGGAGGATGCCAGG + Intronic
1165868292 19:38952521-38952543 TGGGGAGGGTGGAGGGAGAATGG - Intronic
1165881598 19:39047897-39047919 TGGGGGGACAGGAGGAAGTAAGG + Intergenic
1165894959 19:39136081-39136103 AGGGGGGTGACGAGGAAGAGGGG - Intronic
1165901750 19:39172593-39172615 TGAGGGGTTTGGGGGAGGAAGGG - Intronic
1165908521 19:39208835-39208857 GGGCGGGAGTGGAGGAAGACTGG - Intergenic
1165934192 19:39379331-39379353 TGAGGGGTGAGGAGGAGGAAAGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166179385 19:41096032-41096054 TGGGGGCAGTGGGGGAAGGAAGG + Exonic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166356247 19:42229271-42229293 TGGGTGGTGTTGAGCAAGGAAGG + Intergenic
1166677958 19:44750816-44750838 TGGGGAGAGTGGAGGCAGAGAGG - Intronic
1166679688 19:44759027-44759049 TGGGGGGTCTGAAGGAGGAGGGG - Intronic
1166733369 19:45070855-45070877 TGGGGGGTGGGGAGGACAAGGGG + Exonic
1166750332 19:45161503-45161525 TGGGTGGTGGAGAGGAAGACGGG - Intronic
1167059548 19:47135308-47135330 TGGGGGGTGGAGGGGAAGGAGGG - Intronic
1167357009 19:49010460-49010482 GGGCGGGGGTGGGGGAAGAACGG - Intronic
1167449886 19:49560809-49560831 AGGGGGGTGAGGTGGAAGAGAGG + Intronic
1167471024 19:49676659-49676681 GGGGGAGTCTGGAGGAAAAAGGG - Intronic
1167514324 19:49914289-49914311 TGGTGGCGGTGGAGGAAGCAGGG + Intronic
1167598234 19:50438431-50438453 TGGGGTGGGTGGACGATGAATGG + Intronic
1167792308 19:51689884-51689906 CGGGGGAGGTGGAGGAAGACTGG + Intergenic
1168319450 19:55500424-55500446 TGAGGGGTGTGGGGAGAGAATGG + Intronic
1168395342 19:56042753-56042775 TGGGGATTTTGGGGGAAGAATGG - Intronic
1168645421 19:58056256-58056278 TGGGGGCTGTGGAGGCAGCAGGG - Intergenic
925048241 2:790511-790533 TGGAGGGTGAGCAGGATGAAGGG - Intergenic
925436960 2:3846802-3846824 TGGGGGCTGTGGAGTGAGAAGGG + Intronic
925609237 2:5690935-5690957 TGGGGGGTGTGGAGAAGGCGAGG + Intergenic
926070569 2:9885726-9885748 GGGGGCGTGGGGAGAAAGAAGGG - Intronic
926437702 2:12854444-12854466 GGGGAGGTGTGGAGGGAGAGGGG - Intergenic
926846461 2:17146540-17146562 TGGGGGGTGAAGAGAGAGAAAGG + Intergenic
926869104 2:17392441-17392463 TGGAGGGTGAAGAGGAAGCAAGG - Intergenic
927054891 2:19358664-19358686 TGGGGGTGGTGGAGGAGGGAGGG - Intergenic
927130127 2:20051704-20051726 TGGCCTGTGTGGAGGAAGAGGGG - Exonic
927190282 2:20512496-20512518 TGGTGGCTGTGGTAGAAGAACGG - Intergenic
927197110 2:20555635-20555657 AGGGGGGTGGGGAGCAAGGAAGG - Intergenic
927205298 2:20605288-20605310 TGAAGGGTGTGGAGGATGGAAGG - Intronic
927231673 2:20830077-20830099 TGGAGGGTGAAGAGGAAGCAAGG - Intergenic
927265938 2:21151235-21151257 TGGGGGGTGGGGTGGGGGAAGGG - Intergenic
927679338 2:25129772-25129794 TGGGGGAAGTGGGGGAAGACCGG - Intronic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
927783088 2:25954863-25954885 AGTGGGGTGTGGAGGTAGCATGG + Intronic
928113260 2:28527101-28527123 TGGGGGGTGTCTGGGAAGATAGG + Intronic
928277819 2:29919321-29919343 AGGGAGGTGTGGAGGAAGGAAGG - Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928363572 2:30684948-30684970 TGGGGAGTGGGGAGGGGGAAGGG + Intergenic
928464987 2:31515137-31515159 TGGCAGGTGTGGTGGAAGATTGG - Intergenic
928591447 2:32819861-32819883 TGTGGGGTAAGGAGGAAGCACGG - Intronic
928641635 2:33305408-33305430 TGGGGAGTGTTGAGGAAGGGTGG + Intronic
928647847 2:33374074-33374096 TTGGAGGTGTGAAGGAAGACAGG + Intronic
928823440 2:35391233-35391255 TGGGGGGTGTTGGGGAAGGGGGG + Intergenic
929027658 2:37620183-37620205 TGGGGGGTGGAGTGGGAGAATGG - Intergenic
929783771 2:44974541-44974563 AGAAGGGTGTGGAGGAGGAAGGG + Intergenic
929906487 2:46050579-46050601 TGTGGGGTGGGAAGGAAGAAAGG + Intronic
930019440 2:46992527-46992549 TGGGGGCTGAGGTGGGAGAAAGG + Intronic
930117431 2:47730648-47730670 GGGAGGGTGAGGTGGAAGAATGG - Intronic
930197508 2:48524137-48524159 TGGGGGGGGGGGAGGGGGAATGG - Intergenic
930262785 2:49166677-49166699 TGGGAGGATTGGAGGAGGAAGGG + Intergenic
930919048 2:56728891-56728913 TGGGGGGTGTGGACTCAGACTGG - Intergenic
931085912 2:58830662-58830684 TGAGGGGTGGGAGGGAAGAATGG - Intergenic
931130895 2:59334289-59334311 GTGGGGGTGGAGAGGAAGAAGGG - Intergenic
931329110 2:61261492-61261514 AGGGGGGTTGGGAGGGAGAATGG + Intronic
931809308 2:65839032-65839054 TGGGGAGAGTGGAGCAGGAAGGG + Intergenic
932224803 2:70031117-70031139 TGGGGTGAGGGGAAGAAGAAGGG - Intergenic
932258114 2:70304006-70304028 TGGGGGTGGGGGAGGAACAAAGG + Intergenic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
932605487 2:73162985-73163007 GAGGAGGTGTGGAGGAAGGAAGG + Intergenic
932747219 2:74343998-74344020 TGGGAAGTTTGGAGGAAGATGGG + Intronic
932885050 2:75541887-75541909 TGGGGTGCATGGGGGAAGAAAGG - Intronic
932890033 2:75586374-75586396 TGGGGGTTGGGGAGGAAGTATGG + Intergenic
933289933 2:80426733-80426755 TGGGGGTGGTGGAGGAAGGAGGG - Intronic
933316907 2:80726742-80726764 TGGGGGGTGGGGGGGATGTAGGG - Intergenic
933511506 2:83246300-83246322 GGGGAGGTGTGGAGGGAGAGGGG - Intergenic
934504760 2:94881148-94881170 TGGGGCTTGTGGAGAAAGACGGG - Intergenic
934653198 2:96104057-96104079 AGGGGGGAGAGGAAGAAGAAGGG - Intergenic
935002102 2:99028605-99028627 TGAGGGGAGTAGGGGAAGAAGGG - Intronic
935111969 2:100103519-100103541 TGGGGGGAGCAGAGAAAGAAGGG + Intronic
935145617 2:100393147-100393169 GGAGGGGTGTGGTGGAGGAAGGG + Exonic
935188793 2:100759011-100759033 AGGGGCTTGAGGAGGAAGAATGG + Intergenic
935236084 2:101139381-101139403 TGGAGGGTGGCGAGGAAGTAGGG - Intronic
935319423 2:101871583-101871605 TGGAGGAAGTGGAGGAGGAATGG - Intronic
935445637 2:103153539-103153561 TGGGGGTTGAGGAGGGATAAGGG + Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
936123002 2:109761631-109761653 TGGGGGGAGCAGAGAAAGAAGGG - Intergenic
936221684 2:110609833-110609855 TGGGGGGAGCAGAGAAAGAAGGG + Intergenic
937559677 2:123206284-123206306 CAGGGGGTATGGAGGAGGAATGG + Intergenic
938552555 2:132394773-132394795 TGGGGGGTGTTCAGGAACAGTGG - Intergenic
938605625 2:132889904-132889926 TGAGTGGTGTGGAGGAAAGAAGG + Intronic
938655817 2:133432438-133432460 TGGGTGGCATGGAGGAAGGAAGG - Intronic
938697585 2:133848547-133848569 AGGGTGGGGTGGAGAAAGAAGGG + Intergenic
939124906 2:138165803-138165825 TGGGGGCTGTGGAGAAAGATAGG - Intergenic
939152763 2:138493049-138493071 TGGGAGGTGAGGAGCAAGCATGG + Intergenic
939517097 2:143182505-143182527 TGGGTGGTGGGGAGGAAAAGAGG + Intronic
939778208 2:146412116-146412138 TGAGGGGAAAGGAGGAAGAATGG + Intergenic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
941173897 2:162173490-162173512 TTGGGGGTGGGGAGGAAGATTGG + Intronic
941570602 2:167164993-167165015 TGGGAGGAGGGGAGGAAGGAAGG - Intronic
941618632 2:167752581-167752603 AGGGGGGTGTGGGGGGAGAGGGG - Intergenic
942240442 2:173959647-173959669 TGGGGGCTGAGGCGGAAGAATGG + Intronic
942609674 2:177730217-177730239 TGGGGTGTGGGGAGGGAGGAAGG - Intronic
942905879 2:181180108-181180130 TGGGCTATGGGGAGGAAGAAAGG - Intergenic
942994970 2:182249708-182249730 TGGGGGGTAAGGGTGAAGAAGGG - Intronic
943377732 2:187100696-187100718 TGGTGGTGGTGGAGTAAGAAAGG + Intergenic
943489058 2:188527058-188527080 AAGGGAGTGGGGAGGAAGAAAGG - Intronic
944183926 2:196926921-196926943 TGGAGGGTGAGGGGAAAGAAGGG + Intronic
944442000 2:199752221-199752243 TGTGGGGTGGGGAGGGAGAGGGG - Intergenic
944676661 2:202038655-202038677 GGGGTGGTGTGGAGGAAGGCAGG - Intergenic
945529118 2:210927735-210927757 TGGAAGGTGAAGAGGAAGAAAGG - Intergenic
945938739 2:215927577-215927599 GGGGTGGTATGGAGGGAGAATGG - Intergenic
945948528 2:216017027-216017049 TGTGGAGGGTGGAGGTAGAAAGG - Intronic
946057991 2:216918182-216918204 GGGGTGGAGTGGAAGAAGAAAGG + Intergenic
946121094 2:217515569-217515591 TGGGAGGTGTGGAGGAGAAGAGG - Intronic
946163935 2:217852404-217852426 TGGGGGATGAGGAGGCACAAAGG - Intronic
946357182 2:219195247-219195269 TGGGGGGTGGGGAGGTAGGAGGG - Intronic
946563303 2:220937010-220937032 TGGGGGAAGGGGAGGGAGAAGGG + Intergenic
946645684 2:221831400-221831422 TGGAGGCTGTGCAGGAAGCATGG + Intergenic
947011608 2:225572176-225572198 TGGAGGGCTTGGAAGAAGAAAGG - Intronic
947375454 2:229490570-229490592 TGGGGGGTGGGGAGGATGGTAGG + Intronic
947523904 2:230867013-230867035 TGCTGGGTGAGGGGGAAGAAAGG - Intronic
947837772 2:233187954-233187976 TGTGGGGAATGGAGGAAGACAGG - Intronic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948739441 2:240033298-240033320 TGCGGGCTGTGCAGGAACAAGGG - Intergenic
1168780045 20:481476-481498 TGGGGGGTGGGGGGGAGGCAAGG - Exonic
1168876000 20:1172692-1172714 TGGTGGGTGAGGGGGAGGAAGGG + Intronic
1169191590 20:3661758-3661780 TGGAGGGGGTAGAGGAGGAAAGG - Intronic
1169332977 20:4730926-4730948 TGGGTGGTGGGGAGGGAGAGGGG + Intergenic
1169346364 20:4831227-4831249 TGGTGGGTGTGGTGGTAGATTGG - Intergenic
1169498186 20:6134485-6134507 TGAGGGGTGTGGAGGGGGCAGGG - Intergenic
1169774802 20:9240788-9240810 TGGGGGGTTGGGAGGATGAGAGG + Intronic
1171205014 20:23272402-23272424 TGGGAGGTGTGGGAGAAGAGAGG - Intergenic
1171530379 20:25849242-25849264 TGGGAGGTGTGGAGTGGGAAGGG + Intronic
1171836536 20:30156630-30156652 TGGGGTGGGTGGAGGAGGGAGGG + Intergenic
1171982432 20:31637639-31637661 GGGGAGGTGTGGAGGAGGCAGGG + Intergenic
1172115562 20:32571656-32571678 TGGTGGCTGGGGAGGAAGCACGG - Intronic
1172345209 20:34192592-34192614 TTGGGAGTGTGGAGGAAGATAGG + Intergenic
1172393962 20:34585993-34586015 TGTGGGGTGTGGAGTAAGAATGG - Intronic
1172404157 20:34675335-34675357 AGTAGGGTGTAGAGGAAGAAGGG + Intronic
1172865117 20:38089967-38089989 TGGGGGGCTGGGCGGAAGAAGGG - Exonic
1173200874 20:40954316-40954338 AGGGGGGTGGGGACAAAGAAAGG + Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1173427348 20:42954654-42954676 TGTGGGGAGGGGAGGAAGAAAGG + Intronic
1173654459 20:44690156-44690178 TGGGGGCTGTGGAGATAGTAAGG - Intergenic
1173837658 20:46136345-46136367 TTGGGGGTCAGGAGGAGGAAGGG + Intergenic
1174189173 20:48728054-48728076 AGGGTGGTGTTGAGGAGGAATGG - Intronic
1174207263 20:48849810-48849832 TGGGGAGTGGGGGGGAATAATGG + Intergenic
1174256225 20:49257633-49257655 AAGGGGATGAGGAGGAAGAAGGG - Exonic
1174317238 20:49713006-49713028 TAGGGGAAGTAGAGGAAGAAAGG + Intronic
1174339492 20:49886968-49886990 AGGGTGGGGTGGAGGAAGAGTGG + Intronic
1174556677 20:51400464-51400486 TGGGGGGTGGGGGGGCACAATGG + Intronic
1174723775 20:52840281-52840303 CGGGGGGTGGGGAGAAGGAAGGG - Intergenic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1175484413 20:59334930-59334952 TGGGAAATGTGGAAGAAGAATGG + Intergenic
1175504453 20:59471659-59471681 TGGGGTGTGGGGTGGGAGAAAGG - Intergenic
1175567695 20:59993933-59993955 TGGGTGGGGTGGAGGAAAATGGG - Intronic
1175874301 20:62222140-62222162 GGAGGGGTGGGGAGGGAGAATGG - Intergenic
1175892290 20:62321194-62321216 TGGGGCCAGTGGAGGAAGAGGGG + Intronic
1175892324 20:62321280-62321302 TGGGGCCGGTGGAGGAAGAGGGG + Intronic
1175907370 20:62387449-62387471 GGAGGGGTGTGGGGGAACAAGGG - Intronic
1176039154 20:63055238-63055260 TGGGGGGTGTGGAGTGAGGCTGG + Intergenic
1176210804 20:63920361-63920383 TGGTGGGTGTGGTGGGGGAAGGG + Intronic
1176621299 21:9064054-9064076 TGGGGCTTGTGGAGAAAGACAGG + Intergenic
1177239868 21:18443031-18443053 TGGAGGTTGGGGAGGAAGATGGG - Intronic
1177607375 21:23398868-23398890 TGGGAGGTGTGGAGAGAGCAGGG - Intergenic
1177670161 21:24214417-24214439 GCGGGGGTGGGGGGGAAGAAAGG + Intergenic
1177930287 21:27273182-27273204 TGGTGGGTGTGAAAGAGGAAGGG - Intergenic
1178318942 21:31590367-31590389 TGGGGGGAGGGGGGGCAGAATGG - Intergenic
1178330376 21:31685417-31685439 TGGAGTGTGAGGAGGAGGAATGG + Exonic
1178589190 21:33895006-33895028 TGTGGGGTGTAGGGGAAGACAGG + Exonic
1178751273 21:35305745-35305767 AGAGGGGAGGGGAGGAAGAAAGG - Intronic
1178759089 21:35383411-35383433 TGGGGGATGTGGGGGATGGATGG - Intronic
1178974445 21:37209219-37209241 TGGGGGTGTTGGAGGAAGCAAGG - Intergenic
1179280312 21:39928326-39928348 TGGGGGGTGGTGAGGAACGAAGG - Intronic
1179498984 21:41794997-41795019 TGGCGGGTGAGAAGGAAGACTGG + Intergenic
1179587856 21:42385076-42385098 AGGGGGGTGGGGAGGAAAAGAGG - Intronic
1179836225 21:44035436-44035458 TGGGCGGTGAGGAGGAAGAGAGG + Intronic
1179939619 21:44629109-44629131 TGGGGGGTGTGGGTGAGGACTGG - Intronic
1179958018 21:44751875-44751897 TGGAGGGGGCGGAGGGAGAAAGG - Intergenic
1180655053 22:17413253-17413275 TGGAGAGTGTGGAGGAAAACAGG + Intronic
1180865786 22:19118951-19118973 GGGGGTGTGATGAGGAAGAACGG - Intronic
1181690637 22:24557442-24557464 TGTGGGGTGAGGAGGAATGATGG - Intronic
1181711854 22:24696163-24696185 TGGGGGAGGAGGAGGAGGAATGG - Intergenic
1181758732 22:25043108-25043130 TGGGGGGTGGGGAGGAAAGGAGG + Intronic
1181997587 22:26894869-26894891 GGGGAGAAGTGGAGGAAGAAGGG + Intergenic
1182280437 22:29215118-29215140 TGGGGAGTGTGGGGGAAGACTGG + Intronic
1182420994 22:30248516-30248538 TGGGGGAGGTGTAAGAAGAAGGG - Intergenic
1182429829 22:30292926-30292948 TGGGGGATGCTGAGGAAGACTGG - Intronic
1183097548 22:35562227-35562249 GGGGAGGGATGGAGGAAGAAAGG + Intergenic
1183210789 22:36449960-36449982 AGGGGGTTGTGGAGGAAAGAAGG - Intergenic
1183257327 22:36770912-36770934 TGGGAGTTCTGGAAGAAGAAGGG + Intronic
1183281738 22:36935986-36936008 TGGGGTGTCAGGAGGCAGAAGGG + Intronic
1183281805 22:36936260-36936282 TGGCTGGTGTGGAGGAGAAATGG + Intronic
1183314858 22:37131353-37131375 TGGGGGGTGGGGATGAGGTAGGG - Intronic
1183333460 22:37233703-37233725 AGGGGAGTGGGGAGGAATAAAGG + Intronic
1183523799 22:38311907-38311929 TGGAGGCTGAGGCGGAAGAATGG - Intronic
1183685660 22:39360001-39360023 TGGGAGGTGCGGAGGGAGACAGG - Intronic
1183718725 22:39549790-39549812 TGGTGGGTGGGGAGTAAGGATGG - Intergenic
1184148722 22:42626529-42626551 TGGCTGGTGTGGAGGGAGAGAGG - Intronic
1184149252 22:42628936-42628958 TATGGGGTGTGGAGGCAGAGGGG + Intronic
1184167874 22:42741290-42741312 GGGGGGCTGAGGCGGAAGAATGG - Intergenic
1184247865 22:43244825-43244847 TGAGGGGCAGGGAGGAAGAAGGG - Intronic
1184534263 22:45076052-45076074 TGGGGGGTAGGGAGGTGGAAGGG + Intergenic
1184852312 22:47127986-47128008 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852326 22:47128014-47128036 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852365 22:47128108-47128130 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852378 22:47128135-47128157 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852391 22:47128162-47128184 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185047196 22:48534446-48534468 TGAGGAGTGTGGAGGCAGAGAGG + Intronic
1185400089 22:50611125-50611147 TCGGGGGTGTGGAGGAGGTGCGG + Exonic
1203307070 22_KI270736v1_random:116631-116653 TGGAGTGTGTTGAAGAAGAATGG + Intergenic
949826876 3:8174873-8174895 TGGGGTGAGAGGAGGAAGAAGGG - Intergenic
949917746 3:8977605-8977627 TGGGGTGGGTGGAGGGAGAGTGG + Intergenic
950148674 3:10669422-10669444 TGGGAGGTGAGGAGAAAGGAGGG - Intronic
950360244 3:12444813-12444835 ATGGGGGTGGGAAGGAAGAACGG - Intergenic
950611288 3:14128335-14128357 TGGGAGCAGTGGAGGAAGAAAGG - Intronic
950709752 3:14805790-14805812 TGGGGGTTGTGGGGGTAGAGTGG - Intergenic
950742084 3:15060138-15060160 TGGGGGGTGAGAAGTAACAATGG + Intronic
951366559 3:21790320-21790342 TAGATGGTGTTGAGGAAGAATGG + Intronic
951369318 3:21826023-21826045 TGGGGGGTTGAGGGGAAGAAGGG - Intronic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951752137 3:26048346-26048368 TGGGGGATCTGGAAGAATAAGGG - Intergenic
952490204 3:33863413-33863435 TAGGGGGTGGGGATGAAGAGAGG - Intronic
952721122 3:36533739-36533761 TTTGGGGTGTGGAGGAGGTAAGG + Intronic
952727905 3:36607690-36607712 TGGAGGGTTTGGAGGATGAGGGG + Intergenic
952877838 3:37961998-37962020 GGGGGTGGGTGGAGGAGGAAGGG - Intronic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953078109 3:39590022-39590044 AGGGAGTTGTGGAAGAAGAAAGG + Intergenic
953124552 3:40078301-40078323 AGGGAGGTGTGGAGGGAGAGAGG - Intronic
953238351 3:41125961-41125983 TGGGGGTAATGGAGGCAGAATGG + Intergenic
953746624 3:45579342-45579364 TGGAGGATGTGGAGCAAGGAAGG - Intronic
953818956 3:46187786-46187808 TGGGGGATTTGGAGGAGAAAGGG + Intronic
953853670 3:46484838-46484860 TGGGGGCTGCTGGGGAAGAAAGG + Intronic
953980977 3:47412894-47412916 GGGGGGGCGGGGAGGAAGATGGG - Exonic
954105696 3:48408806-48408828 TGGGGGATGAGGAAGAAGGAGGG - Intronic
954115195 3:48463218-48463240 TGTGGGGTGTGCAGGAGGGAGGG - Intronic
954146400 3:48636422-48636444 TGGGGGCTGGGGAGGTAGGATGG - Intergenic
954291416 3:49652027-49652049 TGGGGGCTGGGGTGGAAGAGGGG - Exonic
954683045 3:52356111-52356133 TGGGGAATTTGGAGGCAGAAGGG + Intronic
954725083 3:52601585-52601607 TGGGGGGTGGGGAGGAGGTGGGG + Intronic
954747346 3:52794697-52794719 TGGGAGGAGTGGAGGCAGGAAGG - Intergenic
955144049 3:56298695-56298717 TGGGGGGTGTGGAGTAAATGGGG + Intronic
955911710 3:63864309-63864331 TGGGGGGTGGGGAGGGTGACGGG + Intergenic
956482442 3:69686768-69686790 TGAGGAGTGAAGAGGAAGAAAGG + Intergenic
956527204 3:70178240-70178262 GGGGATGTGTGGAGGAAGGAGGG + Intergenic
956931310 3:74046451-74046473 TGAGGGGTGTGGGGGAAGGAAGG - Intergenic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957801981 3:85097140-85097162 TGGGGTGTGGGGAGGGGGAAGGG - Intronic
957959023 3:87226680-87226702 GGGGGGGTCTCGAGGACGAAGGG - Intergenic
958108904 3:89114325-89114347 TGGTGGGTGTGGTGGCAGCAAGG - Intronic
958646379 3:96880681-96880703 TGAGGTGGGGGGAGGAAGAATGG - Intronic
959259485 3:104057014-104057036 GGTGGGGTGTGGTGGAGGAATGG + Intergenic
959389692 3:105759071-105759093 TGGAGGGTGGGAAGGCAGAAAGG + Intronic
960266207 3:115624012-115624034 TTGAGGGTGTGGACGTAGAAAGG + Intronic
960444350 3:117729577-117729599 TGGGGGTTGTTGAGGGAAAAGGG - Intergenic
960486865 3:118263294-118263316 TGTGGGGTGTGGGGGATGAAGGG - Intergenic
960520044 3:118644242-118644264 TGTGGGCTGTAGAGGAAGCATGG + Intergenic
960870452 3:122244036-122244058 CGGGGAGTGGGGAGGAAGCAGGG + Intronic
960917996 3:122716746-122716768 GGAGGGGTATGGAGGAAGCATGG - Intronic
961164343 3:124753071-124753093 GGGGTGGTGTGGAGAGAGAATGG + Intergenic
961180581 3:124873415-124873437 GTGGGGGAGGGGAGGAAGAAGGG - Intronic
961197321 3:125013661-125013683 TGGTGGGTGTGTAGGACGGAAGG + Exonic
961351391 3:126306896-126306918 TGGGTGGAGTGGAGGGAGAGTGG - Intergenic
961492832 3:127267095-127267117 AGGGGGCCGTGGAGAAAGAAGGG + Intergenic
961560443 3:127724993-127725015 TGGGGGCTGTGGATGAAGGAGGG - Intronic
961721367 3:128898850-128898872 AGGGTGGTGAGGAGGAGGAAAGG - Intronic
961731000 3:128964863-128964885 GGGGTGGTGTGGAGAGAGAACGG - Intronic
961997650 3:131263177-131263199 TGGGGTGGGTGGAGGAGGGAGGG - Intronic
962217278 3:133533459-133533481 AGGGGGAGGTTGAGGAAGAAAGG + Intergenic
962841675 3:139238404-139238426 TGGAGGAAGAGGAGGAAGAAGGG - Intronic
962955721 3:140264969-140264991 TGGGGGTTGTGAAGGAGGGAAGG - Intronic
963613714 3:147507492-147507514 TGGGGGGAGGGAGGGAAGAAGGG - Intronic
963699619 3:148608067-148608089 TGGGGTCTTTGGGGGAAGAATGG - Intergenic
963710079 3:148737393-148737415 TGTGGGGTTTGGGGGAAGGATGG - Intronic
963769825 3:149378567-149378589 TGGGGGGAGGGAAGGAAGGAGGG + Intergenic
963790504 3:149577993-149578015 TGGGGGGAGGGAAGGAGGAAGGG - Intronic
963808769 3:149753632-149753654 TGGAGGGTGTGGAGGAAGAGAGG + Intergenic
964215825 3:154280673-154280695 TGGGGGGTGAGAAGGTAGAGGGG + Intronic
964307910 3:155360762-155360784 TGGGAGGTAGAGAGGAAGAAAGG - Intergenic
964398027 3:156268013-156268035 TGGGGGGTGGGGAGGAAGTGGGG - Intronic
964452182 3:156823051-156823073 AGGGAGGTGTGGAGGGAGAGGGG - Intergenic
964817251 3:160730259-160730281 TGGCTGGGGTGGAGGAAGATAGG + Intergenic
965312209 3:167143290-167143312 TGGGAAGGGAGGAGGAAGAAGGG + Intergenic
965463627 3:169000003-169000025 TGGGGGGAGAGGAGGAGGGAGGG + Intergenic
965713828 3:171581627-171581649 GGGGTGGTGTGGAGAGAGAATGG - Intergenic
965785148 3:172327503-172327525 AGGGGGCTGAGGAGGGAGAATGG - Intronic
965822382 3:172697664-172697686 TGGAGGGAGAGGAGGGAGAAGGG + Intronic
965861465 3:173155706-173155728 GGGGTGGTGTGGAGAGAGAATGG + Intergenic
965906790 3:173718284-173718306 TGGGGGCAGTGGATGAAGAAAGG - Intronic
966486653 3:180478652-180478674 TGGTGGCTCTGGAGGAAGACAGG + Intergenic
966917435 3:184592889-184592911 AGGCGGGTGTGGAAGGAGAAGGG - Intronic
967028151 3:185582425-185582447 AGGTAGGTTTGGAGGAAGAAGGG + Intergenic
967229462 3:187323882-187323904 TGGCTGGAGTGGAGGAAGGAGGG + Intergenic
967559361 3:190900526-190900548 TGGGGACTTTGGAGGAAGAGTGG + Intergenic
967681219 3:192366154-192366176 TGAGGGTTGGGGAGCAAGAAGGG + Intronic
967933329 3:194706573-194706595 TGTGTGGTGTGGAGGAAGGATGG + Intergenic
968876049 4:3268558-3268580 TGGGGCGTGGGGAGGAGGTAAGG + Intronic
969180738 4:5438743-5438765 TGGGGTGTGGGGAGGGAGGAGGG - Intronic
969414113 4:7047715-7047737 AGGAGAGTGTGGAGGAAGGAAGG + Intronic
969600899 4:8175755-8175777 TGTGGGCTGGGGAGGAAGAGAGG + Intergenic
969836863 4:9849272-9849294 AGGAGGGTGTGGAGGCAGACTGG + Intronic
970004419 4:11396898-11396920 GGGGAGGAGTGGAGGAAGACAGG - Exonic
970159604 4:13175682-13175704 TAGGGGGTGTGGAGGAGGTAAGG - Intergenic
970711289 4:18866371-18866393 TGGGGAATATGGGGGAAGAAAGG - Intergenic
971213255 4:24640174-24640196 TGAAGGGTGTGGAGGGATAATGG - Intergenic
971217749 4:24676855-24676877 TGGGAGATGGGGAGGAAGAGAGG - Intergenic
971550724 4:27952830-27952852 TGCAGGCTGTGGAGAAAGAATGG + Intergenic
971790261 4:31161427-31161449 TGACGGGTGTTGAGGAAGCATGG + Intergenic
972166470 4:36291218-36291240 TGTGGGCTGTGGAAGAAGACTGG + Intronic
972367430 4:38389680-38389702 GGAGGTGTGGGGAGGAAGAAGGG + Intergenic
972782729 4:42300123-42300145 AGGAGGGAGGGGAGGAAGAAAGG - Intergenic
972810905 4:42584863-42584885 TGGAGGATTTTGAGGAAGAAAGG - Intronic
973178723 4:47242027-47242049 TGGGGTGGGTGGAGGGGGAAGGG - Intronic
973280504 4:48355286-48355308 TTGGGGGTGAGGAGGCATAAGGG + Intronic
973713263 4:53650270-53650292 TGCGGGGTGTGGAGGACATACGG + Intronic
973774949 4:54233729-54233751 AGGGGAGTGTGGAGGAGGACGGG + Intronic
974033898 4:56800447-56800469 GTGGGGGAGAGGAGGAAGAAAGG - Intergenic
974353189 4:60776042-60776064 TGGGGTGAGTGGAGGAGGGAGGG - Intergenic
974858418 4:67489271-67489293 TGGGGGTGGGGGTGGAAGAAAGG + Intronic
975197355 4:71541366-71541388 TGGATGGTGTGAAGGAAGAAGGG + Intronic
975355349 4:73396106-73396128 TGGGGGTTGTGGAGGGAAATTGG + Intergenic
975685172 4:76913558-76913580 TTGGGGGGTTGGAGGAAGAAAGG - Intergenic
975780386 4:77833191-77833213 TGGGGGGTGGGGAGGAAGTGGGG - Intergenic
975996496 4:80321758-80321780 TGGTGGGTGTGGAGACAGGAAGG - Intronic
976132298 4:81897550-81897572 AGGGGGGAGAGGAGGAGGAAGGG - Intronic
977427853 4:96891692-96891714 TGGGGGCTGAGGCAGAAGAATGG - Intergenic
977546837 4:98393000-98393022 GGGGGCGTGGGGAAGAAGAAAGG - Intronic
977873092 4:102116977-102116999 TGGGGGGTGGGGAGTGAGGATGG - Intergenic
978425681 4:108579829-108579851 GTTGGGGTGTGGGGGAAGAATGG + Intergenic
979311631 4:119210730-119210752 TGGAGGAACTGGAGGAAGAATGG + Intronic
979579081 4:122334510-122334532 TGGGGGCTGGGGAGGAAGTAAGG - Exonic
979698540 4:123640922-123640944 TGGAGGGAGGGGAGGAAGGAGGG + Intergenic
980075619 4:128289981-128290003 TGGGGGGTGGGAGGGAAAAACGG - Intergenic
980252141 4:130331169-130331191 TGGGGATTCTGGAGGTAGAAGGG - Intergenic
980894566 4:138849887-138849909 TGGAGGCTGTGGAGGCAGGAGGG - Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
981688422 4:147480837-147480859 TGGGGGATGTGGAGGAGAGAGGG - Intergenic
981720866 4:147800123-147800145 TGCTGGCTGTGGAGGCAGAAGGG + Intronic
981888711 4:149711277-149711299 TGGGGTATGTGGAGGAATGAGGG - Intergenic
981937341 4:150251148-150251170 TGGGGGGTGTGGGGGATGTGTGG - Intronic
981937348 4:150251166-150251188 TGGGGGGTGTGGGGGATGTGGGG - Intronic
981937388 4:150251257-150251279 TGGGGGGTGTGGGGGATGTGTGG - Intronic
982314922 4:154022636-154022658 TTGGGGGTGTGAAAGAGGAAAGG + Intergenic
982326101 4:154129392-154129414 TGGGGGGTATAGAGGAAGATGGG + Intergenic
982692743 4:158566930-158566952 GGGGAGGTGTGGAGGGAGAGGGG + Intronic
982900752 4:161000023-161000045 TGGGGTGGGGGGAGGGAGAAGGG - Intergenic
983144467 4:164196810-164196832 TGGGGGTTGTGGAGGGAGGGAGG - Intronic
983273678 4:165592138-165592160 TGGGGGCTTTGGAGGAAGACTGG + Intergenic
983390478 4:167124520-167124542 TGGAGGGTGTGGGGGAGAAAAGG - Intronic
983479529 4:168256078-168256100 GGGGGAGTGGGGAGGGAGAAGGG - Intronic
983656620 4:170090691-170090713 AGGGAGGTGGGGAGTAAGAAGGG - Intronic
984209669 4:176830425-176830447 TGGGGTGAGGGGAGGAGGAATGG + Intergenic
984372089 4:178881555-178881577 TGGAGGGTGTAGAAGAAGATAGG + Intergenic
984621307 4:181955604-181955626 TGTGGGGAGGGGAGGAACAAGGG + Intergenic
984664000 4:182405853-182405875 TGGAGGGTATGGAGGAATAAAGG + Intronic
984781949 4:183533960-183533982 TGGGGGTTGTGGGGGAAGAACGG + Intergenic
984835078 4:184011795-184011817 TGGGGGCGGGGGAGGAAGATAGG + Intronic
985874820 5:2586663-2586685 TTTGGGGAGTGGAGGAAGAGAGG + Intergenic
985972526 5:3389664-3389686 TGGGAGGTGTGGAGGTGGAATGG - Intergenic
985997880 5:3606716-3606738 TGGCGGGGGTGGAGGGAGACCGG + Intergenic
986137589 5:4997002-4997024 TGGGGGTTATGGGGGGAGAATGG - Intergenic
986357406 5:6942367-6942389 TGGGGGATGAGGTGGAAGGATGG + Intergenic
986548580 5:8926835-8926857 TGGGGGGTCAGGAGGAAGTAGGG + Intergenic
986738337 5:10683663-10683685 TGGAGGGCGTGGAGGCAGAATGG + Intronic
986769441 5:10958391-10958413 CAGGGGATGTGGAGGAAGGAGGG - Intergenic
986831618 5:11585838-11585860 TGGGGGGTGAGGAGAAAGGAGGG + Intronic
987005362 5:13704616-13704638 TGGAGGTTGTGGTTGAAGAATGG - Intronic
987312473 5:16694080-16694102 TTGAATGTGTGGAGGAAGAATGG - Intronic
987524560 5:19030780-19030802 TGAGTTGTGAGGAGGAAGAAGGG - Intergenic
987846190 5:23290407-23290429 TGGTGGGTGGCGAGGAATAAAGG - Intergenic
988786045 5:34566181-34566203 AGTGGGGTGTGGAGGTGGAATGG - Intergenic
988967330 5:36432365-36432387 AGGGGAGGGGGGAGGAAGAAAGG + Intergenic
989039183 5:37209217-37209239 TGAGGGGTCGGGAGGAACAAGGG - Intronic
989102434 5:37835206-37835228 TGGTTGGGGTGGAGGACGAAGGG - Intronic
989403367 5:41033334-41033356 TGGGTGGTAGGGAGGAAAAATGG - Intronic
990122478 5:52471925-52471947 TGGGGGCTGGGGAGTAAGGAGGG - Intergenic
990230892 5:53712219-53712241 TGGGGGGTCTGGATGAGGCAGGG - Intergenic
990237125 5:53780470-53780492 TGGGGGTTGTGGCGGTGGAAGGG - Intergenic
990609314 5:57441630-57441652 TGGGGGGTGAGGTGGATAAAAGG - Intergenic
991063548 5:62403252-62403274 AGGTGGGTGTGGAAGAGGAAAGG - Exonic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
992260535 5:74965953-74965975 TGGAGGGTGAGGAACAAGAAGGG + Intergenic
992692117 5:79251098-79251120 TGGAGGGTGGGGAGAAAGATTGG + Intronic
992784432 5:80156038-80156060 TGGGGGCTCTGGAGGGCGAAGGG + Intronic
992793871 5:80238158-80238180 TGGGGGGCGGGGAGGAATGAGGG - Intronic
993209879 5:84934463-84934485 TGGGGGGTGGGGTGGAAGAGAGG - Intergenic
993622047 5:90179892-90179914 TGGGGGGTGTGGGGGGTGAAGGG + Intergenic
993962775 5:94320461-94320483 TGAGGGGGGTGGATGAAGACAGG - Intronic
994044461 5:95292203-95292225 TGGGGCTTTTTGAGGAAGAAAGG + Intergenic
994144228 5:96374804-96374826 TGGTAGTTGTGGTGGAAGAAAGG + Intergenic
994609132 5:102014006-102014028 TAGGGAGTGTGGGGGAAAAATGG - Intergenic
994957202 5:106547005-106547027 TGGGAGGGATGGAGGCAGAAAGG + Intergenic
996008379 5:118451232-118451254 ATGGGGGTGGGGAGGAAGAATGG + Intergenic
996026447 5:118651406-118651428 TGGGAGGAGGGGAGGATGAATGG + Intergenic
996805113 5:127445996-127446018 AGGGGGGTGAGGAGGAAGAGAGG + Intronic
997138246 5:131349340-131349362 TGGGGTGGGGGGAGGGAGAAGGG + Intronic
997383037 5:133450957-133450979 TGGGGTGAGTGGAGGGAGACAGG + Intronic
997837773 5:137210209-137210231 GGGAGGGTGTGCAAGAAGAAGGG - Intronic
998114299 5:139524548-139524570 TTGGGGGTGGGGTGGACGAAAGG - Intergenic
998156511 5:139789850-139789872 TGGGAGATGTGGATGAAGGAGGG + Intergenic
998199470 5:140108032-140108054 TGCGGGCTGAGGAGGAAGGAGGG - Intronic
999231297 5:150063649-150063671 TGGGATGTGGGGAGGAGGAATGG + Intronic
999618460 5:153450207-153450229 TGGGTGGTATGGAGAGAGAATGG + Intergenic
999821553 5:155233861-155233883 GGGGAGTTGTAGAGGAAGAAAGG + Intergenic
1000050836 5:157561720-157561742 AGGGGAGTGTGGAGGTAGAATGG - Intronic
1000437007 5:161224723-161224745 TGGGCGGGGTTGCGGAAGAAAGG + Intergenic
1000464638 5:161560563-161560585 AGGGGGAGGGGGAGGAAGAATGG + Intronic
1000532286 5:162438255-162438277 TGGGGGCTGAGGCGGGAGAATGG - Intergenic
1000997626 5:167974422-167974444 AGGGAGGGGTGGAGGAAGGAGGG + Intronic
1001200564 5:169712252-169712274 TGAGGGGAGTGCAGGAAGAAAGG + Intronic
1001279208 5:170374295-170374317 TGAGGGGTAGGGAGGGAGAATGG + Intronic
1001412918 5:171523588-171523610 TGTGGGGAGTGGAAGAAGGAGGG + Intergenic
1002365533 5:178706762-178706784 TGAGGGCTGTGGCAGAAGAAGGG - Intergenic
1002423060 5:179159910-179159932 TGAGGATTGTGGAGGAAAAAAGG - Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002665084 5:180817115-180817137 AGAGGGGTATGGAGGGAGAAGGG + Intergenic
1002792249 6:445159-445181 GGCGTGGTGTGGAGGGAGAACGG + Intergenic
1002829818 6:809546-809568 TGGCAGATGTGAAGGAAGAAGGG + Intergenic
1003081168 6:3023000-3023022 CTGGGGGCGTTGAGGAAGAAGGG - Intergenic
1003308648 6:4950017-4950039 GCGGGGCTGTGGAGGAAGACCGG + Intronic
1003408635 6:5843946-5843968 TGGTGGCTGAGGAGGAAGACAGG + Intergenic
1003681155 6:8258401-8258423 AGGAGGGAGAGGAGGAAGAAGGG + Intergenic
1003956637 6:11171061-11171083 AGGGAGGTGTGGAGGGAGAGGGG + Intergenic
1005449897 6:25962411-25962433 TGAAGGGTGTGGTGGAAAAAGGG - Intergenic
1006026716 6:31151577-31151599 TGGGGTCTGTGGAGCAAGGAGGG - Intronic
1006067436 6:31472020-31472042 TGGAGGGCCTGGAGGAAGAGGGG + Intergenic
1006090233 6:31624375-31624397 GGAGGGGTGGGGAGGAAGAATGG + Intronic
1006101830 6:31690306-31690328 TGGGGTGTGTGGTGGGGGAATGG + Intronic
1006176947 6:32128204-32128226 TGGGGGGTGGGGGGGAAAGATGG - Exonic
1006409318 6:33863137-33863159 GGGGGGAGGTGGAGGAGGAAGGG + Intergenic
1006496141 6:34425047-34425069 AGGAGGGTGAGGAGGAAGATGGG - Intronic
1006809095 6:36808421-36808443 TGGGTGATGAGGAGGAAGAAGGG - Intronic
1006946647 6:37788893-37788915 TGGGGGGTGTTGACTAGGAAGGG - Intergenic
1007158342 6:39768148-39768170 TGGGGTGGGGGGAGGGAGAAGGG + Intergenic
1007231710 6:40352809-40352831 TGGGGGTGGTGGGGGAAGATTGG - Intergenic
1007243704 6:40444982-40445004 TGGAGGGGGTGCAGGAAGGAGGG - Intronic
1007317147 6:40998363-40998385 TGGGGTGTGGGGAGGAAGATGGG + Intergenic
1007373015 6:41439211-41439233 TTTGGGGTGTTGAGGAAGCAGGG + Intergenic
1007418078 6:41703630-41703652 AGAGGGGAATGGAGGAAGAAAGG + Intronic
1007471029 6:42090531-42090553 TAGAGGGTGTGGAGGAGGAAGGG + Intergenic
1007585728 6:42988100-42988122 TTGGAGGTGGGGAGGAAGAAAGG - Intronic
1007614841 6:43173823-43173845 TGAGGGGTGAGGAGGGAGATGGG - Intronic
1007712983 6:43836361-43836383 TGGAGAGTGGGGAGGAGGAAGGG + Intergenic
1007719773 6:43878144-43878166 GGGGGGGTGTGGAGGGTGAGTGG + Intergenic
1007789609 6:44301557-44301579 TGGGGTGGGTGGGGGAAGCAGGG - Intronic
1008160472 6:48069156-48069178 GGGGGGGAGAGGAGGGAGAAGGG + Intergenic
1008232579 6:49001765-49001787 TAATGGGTGAGGAGGAAGAAGGG - Intergenic
1008408666 6:51147561-51147583 TGGGGTGAAGGGAGGAAGAAGGG + Intergenic
1008863188 6:56176634-56176656 AGGGGGGGAAGGAGGAAGAAAGG + Intronic
1009287726 6:61843165-61843187 TGGGGGCGGTGGAGGAGGAATGG + Intronic
1009394349 6:63180463-63180485 TGAGGGGAGTGGAGGGGGAAAGG + Intergenic
1011087640 6:83560203-83560225 AGGAGGCTGAGGAGGAAGAATGG + Exonic
1011974730 6:93282634-93282656 GGGGAGGTGTGGAGGGAGAGGGG + Intronic
1012124706 6:95413665-95413687 TGGGAGGAGGGGAGGAAGACTGG + Intergenic
1012180248 6:96143881-96143903 TGGGTGGTGTGGAATAAGCAAGG - Intronic
1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG + Intergenic
1012474461 6:99604768-99604790 CGGGGGGTGGGGAGGAGGAGAGG - Intergenic
1012689822 6:102296799-102296821 GGGGTGGTATGGAGGGAGAATGG - Intergenic
1013639574 6:112060068-112060090 TGGCTGGTGTGGAGGCAGCAAGG + Intronic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1013924099 6:115447192-115447214 TGGGGTGGGGGGAGGAGGAAGGG + Intergenic
1014139159 6:117920376-117920398 TGGCAGTTGTGGAGGAAAAACGG - Intronic
1014385519 6:120796928-120796950 AGGGAAGTGTGTAGGAAGAAAGG - Intergenic
1014433089 6:121392043-121392065 TGGGAGGGGTAGAGGAAGGATGG + Intergenic
1014813042 6:125906667-125906689 TGGGGAGAGAGGAGGAAGAGGGG + Intronic
1014851256 6:126341857-126341879 TGGGTTCTTTGGAGGAAGAAAGG - Intronic
1014999789 6:128200863-128200885 GGGAGGGTGAGGAGGAAGAAGGG + Intronic
1016177442 6:141097974-141097996 TGGGGTGTGGGGAGGAGGCAGGG - Intergenic
1016995574 6:149960573-149960595 TGGGGGGTCAGGAGGAAGGGAGG - Intergenic
1017391874 6:153948836-153948858 TGGGGACTGTGGAGGAAGGTTGG + Intergenic
1017432518 6:154385107-154385129 TGGGGAGAGGGGAGGAAAAAGGG - Intronic
1017814888 6:158009526-158009548 AGGGGGCTGAGGAGGTAGAAGGG + Intronic
1017967197 6:159276806-159276828 AAAGGGGTGGGGAGGAAGAATGG - Intergenic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018699546 6:166415909-166415931 TGGGGGTGATGGAGGAAGGACGG - Intronic
1019030372 6:169005044-169005066 TGGGGGATGTCTAGGAAGGATGG - Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019187907 6:170231719-170231741 TCTGGGGTGGGGAGGAAAAAGGG - Intergenic
1019286976 7:228527-228549 TGGGGGCTGTGGAGGGTGGAAGG + Exonic
1019670784 7:2277107-2277129 TGGGAGGTGTGGAGTCAGCAGGG - Intronic
1019776493 7:2914786-2914808 TGGAGGCTGAGGCGGAAGAATGG - Intronic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019908591 7:4083640-4083662 AGGGAGGGGTGGAGGAAGGAAGG - Intronic
1019936722 7:4262795-4262817 TAGGGGGTGATGAGGTAGAAGGG - Intronic
1019936765 7:4262901-4262923 TGGGGGGTGATGAGGTAGAGGGG - Intronic
1019936781 7:4262935-4262957 TGGTGGGTGATGAGGTAGAAGGG - Intronic
1019936836 7:4263070-4263092 TGGGGGGTGATGAGGTAGAAGGG - Intronic
1020035278 7:4959943-4959965 TGGGGGGTTGGTGGGAAGAAGGG + Intergenic
1020111590 7:5450964-5450986 TGGGGGGTGTGGAGGCACTGGGG + Intronic
1020290889 7:6721508-6721530 AGGCGGGTGTGTGGGAAGAATGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021174762 7:17438369-17438391 TGGGGGGTGTGTGGAAAGAGTGG + Intergenic
1021276943 7:18663448-18663470 TGGGGGGTGAGGGGGAGGGAGGG - Intronic
1021351260 7:19596627-19596649 TAGAGAGTGGGGAGGAAGAAAGG - Intergenic
1022011368 7:26310602-26310624 TTGGGGGTGGGGAGGTGGAAAGG + Intronic
1022019811 7:26387625-26387647 CGAGGGGGGTGGAGGAAGGAAGG - Intergenic
1022660180 7:32359834-32359856 TGGGTGCTGGGGAGGAAGGAAGG - Intergenic
1023139410 7:37086140-37086162 GGAGGGCTGTGGAGGAGGAAGGG - Intronic
1023365312 7:39457998-39458020 GGCGGGGTGGGGAGGAAGGAGGG - Intronic
1023533472 7:41183237-41183259 TGAGGGGAGGGGAGGAAGGAAGG - Intergenic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1023824582 7:44000478-44000500 AGGAGGGTGTGTGGGAAGAATGG + Intergenic
1023824821 7:44001995-44002017 AGGAGGGTGTGTGGGAAGAATGG + Intronic
1024083199 7:45872912-45872934 TGGCGGGTGGGTAGGAAGGAAGG - Intergenic
1024217157 7:47257118-47257140 TACAGGGTGTGGAGGAAGAAGGG + Intergenic
1024479979 7:49852997-49853019 TGTGGGGTGAGGAAGAGGAAAGG - Intronic
1025005280 7:55349365-55349387 TGAGAGCAGTGGAGGAAGAAGGG + Intergenic
1025913410 7:65846408-65846430 TGGGGGGAGTGAGGGAGGAAAGG - Intergenic
1025943093 7:66087705-66087727 TGGGGGGGTGGGAGGAAGCAGGG - Intronic
1026024156 7:66731933-66731955 TGGGGGGAGTGGATGGAGACAGG - Intronic
1026088134 7:67279240-67279262 AGGAGGGTGTGTGGGAAGAATGG + Intergenic
1026088370 7:67280769-67280791 AGGAGGGTGTGTGGGAAGAATGG + Intergenic
1026450159 7:70521785-70521807 TGGGCCGTTTGGAGGGAGAATGG - Intronic
1026725883 7:72869572-72869594 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1026726109 7:72871031-72871053 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1026747957 7:73027416-73027438 GGGAGGGTGTGTGGGAAGAATGG - Intergenic
1026751605 7:73055555-73055577 GGGAGGGTGTGTGGGAAGAATGG - Intergenic
1026755254 7:73083670-73083692 GGGAGGGTGTGTGGGAAGAATGG - Intergenic
1026758904 7:73111702-73111724 GGGAGGGTGTGTGGGAAGAATGG - Intergenic
1026959479 7:74399233-74399255 TGGGGGCAGTGTAAGAAGAAGGG + Intronic
1027034161 7:74912706-74912728 GGGAGGGTGTGTGGGAAGAATGG - Intergenic
1027088502 7:75281783-75281805 GGGAGGGTGTGTGGGAAGAATGG + Intergenic
1027092145 7:75309711-75309733 GGGAGGGTGTGTGGGAAGAATGG + Intergenic
1027095788 7:75337678-75337700 GGGAGGGTGTGTGGGAAGAATGG + Intergenic
1027117732 7:75494573-75494595 AGGAGGGTGTGTGGGAAGAATGG + Intergenic
1027117972 7:75496074-75496096 AGGAGGGTGTGTGGGAAGAATGG + Intergenic
1027273833 7:76539386-76539408 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1027274072 7:76540907-76540929 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1027323552 7:77030016-77030038 GGGAGGGTGTGTGGGAAGAATGG - Intergenic
1027327280 7:77058440-77058462 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1027327514 7:77059959-77059981 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1027599779 7:80225504-80225526 TGGGAGGTGTGGAGAAAGAAAGG - Intergenic
1028720257 7:94022585-94022607 TGGGGAGTGTGTAGAAAGTAAGG - Intergenic
1029071764 7:97905308-97905330 AGGTGGGTGTGGTTGAAGAAAGG - Intergenic
1029395888 7:100308395-100308417 GGGAGGGTGTGTGGGAAGAATGG + Intronic
1029396110 7:100309781-100309803 GGGAGGGTGTGTGGGAAGAATGG + Intronic
1029396335 7:100311171-100311193 GGGAGGGTGTGTGGGAAGAATGG + Intronic
1029396560 7:100312561-100312583 GGGAGGGTGTGTGGGAAGAATGG + Intronic
1029396785 7:100313954-100313976 GGGAGGGTGTGTGGGAAGAATGG + Intronic
1029714707 7:102319629-102319651 TGGGGTGTGTGGGGCAAGAGGGG - Intronic
1029719531 7:102353972-102353994 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1029719765 7:102355482-102355504 AGGAGGGTGTGTGGGAAGAATGG - Intergenic
1029722422 7:102377839-102377861 GGAGGGGAGGGGAGGAAGAAAGG - Intronic
1029743291 7:102503246-102503268 TGGTGGGGGTGGAGGAAGATTGG + Intronic
1029752848 7:102553776-102553798 AGGAGGGTGTGTGGGAAGAATGG + Intronic
1029753084 7:102555300-102555322 AGGAGGGTGTGTGGGAAGAATGG + Intronic
1029761280 7:102602407-102602429 TGGTGGGGGTGGAGGAAGATTGG + Intronic
1029770799 7:102652868-102652890 AGGAGGGTGTGTGGGAAGAATGG + Intronic
1029771035 7:102654383-102654405 AGGAGGGTGTGTGGGAAGAATGG + Intronic
1030520378 7:110590515-110590537 TGGGAGGGGAGGAGGAAGCATGG + Intergenic
1030806720 7:113928974-113928996 TGGGGGGCTTGGAAGAAGACAGG + Intronic
1030901992 7:115136183-115136205 TGGGTGGTGTAGAGCAGGAAAGG + Intergenic
1031054362 7:116977439-116977461 GGAGGGGTGGGAAGGAAGAAAGG + Intronic
1031118565 7:117694731-117694753 TGGGGGGTGGGGATAAAGAGAGG + Intronic
1031151699 7:118061375-118061397 TGGTGGGTGTGGATGAAGTTGGG + Intergenic
1031179256 7:118393974-118393996 TGGGGTGTGGGGAGGAGGGAGGG + Intergenic
1031527627 7:122840279-122840301 TGGGGTGGGGGGAGGAGGAAGGG + Intronic
1031931263 7:127688221-127688243 TGAGGGGTGTGAGGGAAGGATGG - Intronic
1032100509 7:128972688-128972710 TGGGGGGTTTCAGGGAAGAAGGG + Intronic
1032176872 7:129637126-129637148 TGAGTGGTGAGGAGGATGAATGG + Intronic
1032540124 7:132695883-132695905 TGGGGTGTGGGGAGGGAGGAGGG + Intronic
1032662881 7:134005112-134005134 TGGGAGTTTGGGAGGAAGAAAGG + Intronic
1032869588 7:135969088-135969110 TGGGGGGGGGGGAGGAGGGAGGG + Intronic
1033116824 7:138632710-138632732 AGGGGGTTGTGGAGGGAGGATGG + Intronic
1033245068 7:139710959-139710981 TGCGGGGTGTATAGGAAGCATGG - Intronic
1033535878 7:142311914-142311936 TGAGGGGTGTGGTGGGAGCAGGG + Intergenic
1034386696 7:150746332-150746354 TTGGGGGCTTGCAGGAAGAAAGG - Intronic
1034419104 7:150979628-150979650 TGGGGGGAGGGGAAGAACAAAGG + Intergenic
1034641085 7:152603105-152603127 TGGGCAGTGTGTGGGAAGAAAGG + Intergenic
1034859121 7:154581266-154581288 TGGGGAAGGTGGAGGGAGAAGGG + Intronic
1035181012 7:157089578-157089600 TGGGAGGAGTGGGGGAAGAGGGG + Intergenic
1035425177 7:158766062-158766084 TGGCGGCTGAGGTGGAAGAATGG + Intronic
1035559516 8:594096-594118 AGGCCTGTGTGGAGGAAGAAGGG - Intergenic
1036185946 8:6622410-6622432 TGGGGAATGCGGAGGAAGCAGGG + Intronic
1036239966 8:7073308-7073330 TGGGGGCGGTGGAGGAGGAGGGG - Intergenic
1036788681 8:11703891-11703913 GGGGGGGCGGGGAGGGAGAAAGG + Intronic
1036928105 8:12927251-12927273 GATGGGGTTTGGAGGAAGAAGGG - Intergenic
1036971720 8:13362653-13362675 AGGGGGGTGTGGAAGAGGGAAGG + Intronic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037316606 8:17605276-17605298 TGGGGCATGGGGAGGAAGGATGG - Intronic
1037583960 8:20263725-20263747 TGGGGCGCGGGGTGGAAGAAGGG + Intronic
1038231901 8:25708348-25708370 TGGGGGGAAGGGAGGAGGAAAGG + Intergenic
1038277638 8:26135075-26135097 TTGAGGGTGTGGCAGAAGAAGGG - Intergenic
1038554349 8:28495832-28495854 GGGGGGGTATGGTAGAAGAAAGG - Intronic
1038641966 8:29336130-29336152 TTGGGTGGGAGGAGGAAGAAAGG - Exonic
1038641980 8:29336248-29336270 TTGGGTGGGAGGAGGAAGAAAGG - Exonic
1038773083 8:30502216-30502238 TGGGGGGCGGGTATGAAGAAGGG + Intronic
1039126425 8:34207053-34207075 TGGGGGGAGTGGAAGAGGGAGGG + Intergenic
1039385504 8:37132066-37132088 CGGGGGGTGGGGGGGAACAAGGG - Intergenic
1039465020 8:37778827-37778849 TGGTGGCTGAGGTGGAAGAATGG + Exonic
1039481271 8:37875098-37875120 TGGGGGATGGGGAGGAGGACGGG + Exonic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1039729837 8:40262700-40262722 TGGGGTTTGGGGAGGAGGAAGGG - Intergenic
1039870350 8:41540490-41540512 TGGAGGGTGTGGAGAGAGGAGGG + Intronic
1040071920 8:43195607-43195629 AGGAGGGTGTGGAGGAGGATGGG + Intronic
1040090234 8:43391216-43391238 TGGGGTGTGGGGAGGGAGGAGGG - Intergenic
1040341866 8:46445134-46445156 AGGGGGATGTTGAGGCAGAAGGG - Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1040531550 8:48270446-48270468 TGGAGGATGTGGAGGCAGAGCGG + Intergenic
1040561104 8:48524157-48524179 TGGGGGAGTTGGAGGCAGAATGG + Intergenic
1040903223 8:52438789-52438811 TGGGGTGTGTGGAGGGTGTAGGG + Intronic
1041015875 8:53592858-53592880 TGGGGGGTGAGGGGCAAGAGAGG - Intergenic
1041289810 8:56297955-56297977 TGGATGGTGTGGAGGAGCAATGG + Intergenic
1042227892 8:66528915-66528937 TGGGGGGTGGGGATGAAGGCTGG + Intergenic
1042508760 8:69589703-69589725 TGGGGGGTGGGAAGGCACAAGGG + Intronic
1042600450 8:70494384-70494406 TGGGGGTTGGGGTGGGAGAATGG - Intergenic
1042713718 8:71748054-71748076 TGGGGAGGGTGGAGGGAAAATGG - Intergenic
1042989739 8:74626018-74626040 TGTGGAGGGTGGGGGAAGAAAGG - Intronic
1043022629 8:75023389-75023411 TGGGGTTTCTGCAGGAAGAAGGG - Intronic
1043110080 8:76169595-76169617 AGGGAGGTGTGGAGGGAGAGGGG + Intergenic
1043247174 8:78019051-78019073 TGTGTGGAGTTGAGGAAGAAGGG - Intergenic
1043859607 8:85300479-85300501 TGGTGGGGGTGGGAGAAGAAGGG + Intergenic
1044036212 8:87306747-87306769 TTGGGGATGTGGGGGAAGAGTGG + Intronic
1044423788 8:92028081-92028103 GGGGGGGTGGGAAGGAAGGAGGG + Intronic
1044441607 8:92230776-92230798 AGGGGGGTGTGGAGGGAGAGGGG + Intergenic
1044602357 8:94018147-94018169 TTGGGAGTGGAGAGGAAGAATGG - Intergenic
1044722810 8:95167429-95167451 AAGGGGGTGTGGAGGAGGCAAGG - Intergenic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1045068786 8:98478322-98478344 TTGGGGGTGGGGTGGAAGAAGGG + Intronic
1046273273 8:111923470-111923492 TGGGAGGTGGGGAGTGAGAATGG + Intergenic
1047211074 8:122840975-122840997 TTCCGGGTGTGGAGGATGAACGG - Intronic
1047252495 8:123191519-123191541 TGGGGAGTGCAGAGGAGGAAGGG - Intronic
1047296552 8:123575625-123575647 TGGGGGCTTGGGAGGAAGAGTGG + Intergenic
1047826534 8:128582179-128582201 GGAGGGGAGGGGAGGAAGAAAGG - Intergenic
1047892789 8:129331116-129331138 TGGGGGGCGGGGAGGAAGGGGGG + Intergenic
1048265934 8:132985945-132985967 AGGGGGTTGTGGAGGGAGAGAGG + Intronic
1049033555 8:140056303-140056325 AGGAGGCTGAGGAGGAAGAATGG + Intronic
1049199226 8:141331727-141331749 CGGGGTGTGTGGAGGAAGGAAGG + Intergenic
1049235519 8:141510478-141510500 GAGGGGGTGTGGAGGAGGAGGGG - Intergenic
1049446697 8:142634591-142634613 GGAGGGGAGTGGAGGAAGCAAGG - Intergenic
1049800127 8:144513816-144513838 TGGGCGGTGGGGAGTGAGAAGGG + Intronic
1049814188 8:144590541-144590563 TGCAGGCTGTGGAGGAAGCATGG - Intronic
1049823597 8:144652762-144652784 TGGAGGGTGGGGAGGAGGGAGGG + Intergenic
1049978371 9:881796-881818 TTGGGGGTGGAGAAGAAGAAAGG - Intronic
1050061963 9:1718852-1718874 TGGGAAGTCTGGAGGGAGAAAGG - Intergenic
1050472667 9:6008354-6008376 TGGGCGGTGAGGGGGGAGAAAGG + Intergenic
1050610270 9:7344828-7344850 AGGGAGGGGTGGAGGAAGGAGGG + Intergenic
1050821867 9:9889120-9889142 TGGGGGTGGTGGAGGAAGTTGGG + Intronic
1050922332 9:11219905-11219927 TGGAGGGTGTGGAGCAGCAAAGG - Intergenic
1051184439 9:14443451-14443473 TAGGTGATGTGGAAGAAGAAGGG - Intergenic
1051235888 9:14998264-14998286 TGGGGTGTGGGGAGGGGGAAGGG + Intergenic
1051253789 9:15190855-15190877 TGGGAGGGGTGGGGGAAGAGAGG - Intronic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051439470 9:17068823-17068845 TGGAGGCTGTGGAACAAGAATGG + Intergenic
1051741922 9:20260785-20260807 TGAGGGGTGGTGAGGAATAAAGG - Intergenic
1051983547 9:23054268-23054290 GGAGGGGAGTGGATGAAGAAAGG + Intergenic
1052363668 9:27587888-27587910 TGGTGGGGGTAGAGGAGGAAAGG - Intergenic
1052563540 9:30116850-30116872 TAGGGGGTGGGGAGGTAGGAGGG + Intergenic
1052864589 9:33457243-33457265 TGGAGGTTGTGGAGGGAGACTGG + Intergenic
1052864788 9:33458350-33458372 GGTGGAGTGTGGAGGAAGAAAGG - Intergenic
1053186473 9:36020694-36020716 GGGGGTGGGAGGAGGAAGAAAGG + Intergenic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1053420808 9:37976482-37976504 TGGGGGCTGAGGAGGGATAATGG - Intronic
1055451731 9:76436958-76436980 TGGGGTGTGGGGAGGGGGAAGGG + Intronic
1056045858 9:82715182-82715204 TGGGGGGTGTTCAGGACTAAAGG - Intergenic
1056098383 9:83277078-83277100 TGGGATGTGTGGAGGAAAGATGG + Intronic
1056787530 9:89603863-89603885 TGGGGGGAGGGGAGGACAAAAGG + Intergenic
1056883387 9:90417780-90417802 TGGGGGGTATGGAGAGAGAATGG - Intergenic
1057416171 9:94863998-94864020 TTGGGGGTACTGAGGAAGAAGGG + Intronic
1057495122 9:95554471-95554493 TAGGAGGTGTGATGGAAGAAGGG - Intergenic
1057528910 9:95826931-95826953 GGGCAGGTGTGCAGGAAGAAGGG - Intergenic
1057637990 9:96788526-96788548 TGCGGGCTGTACAGGAAGAATGG - Intergenic
1057799626 9:98182447-98182469 TGGGGAGTGTGGAGGAGGGCTGG - Intronic
1058078513 9:100675701-100675723 TGTGTGGTGTAGAGGAAGGATGG + Intergenic
1058148631 9:101439877-101439899 GGGGTGGTGGGGAGGATGAATGG - Intergenic
1058930552 9:109714819-109714841 TGGTGGATGAGGAGGAATAACGG + Intronic
1059299286 9:113299190-113299212 GGTGGGGTGGGGAGGAAGATGGG + Exonic
1059431543 9:114253442-114253464 GGGCGGGAGGGGAGGAAGAAAGG + Intronic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1059773521 9:117451106-117451128 TTGGGAGTGGGGAGAAAGAATGG - Intergenic
1060060913 9:120458671-120458693 TGGGGTGTGTGGAGAGAGGATGG + Intronic
1060149592 9:121279741-121279763 TTTGGGGTGTGTAGAAAGAAGGG + Intronic
1060185980 9:121564530-121564552 TGGGGGTTGAGGAGGCAGAAGGG - Intergenic
1060214835 9:121732499-121732521 TGGCTGGTCTGGAGGGAGAAGGG + Intronic
1060453909 9:123771866-123771888 TGGGGGGAGGGGAGGGGGAAAGG + Intronic
1060520590 9:124291959-124291981 TGGGGTGGGTGCAGGAAGAAGGG - Intronic
1060667374 9:125439898-125439920 AGGGAGGTGTGGAGGAGGGAAGG + Intronic
1061306558 9:129736091-129736113 TGGGGGGTGTGGAGAAGGGGTGG - Intergenic
1061371166 9:130198318-130198340 TGGGGGGTGTCAAGGGAGAGTGG + Intronic
1061391539 9:130319714-130319736 TGGGGGGTGGGCAGGGAGACAGG + Intronic
1061782368 9:133003680-133003702 TGGGGGGTCTGGAGGCCCAAGGG + Intergenic
1061847186 9:133394418-133394440 TGTGGGGTGTGGGGGAGGGAGGG - Intronic
1061886969 9:133596053-133596075 GGGTGGGTGTGGAGGCAGAGTGG + Intergenic
1061947111 9:133914657-133914679 AGGGGGGAGGGGAGGAAGCAAGG + Intronic
1062012353 9:134273975-134273997 TGGGGGGTTTGGGGGAAGGCAGG - Intergenic
1062255778 9:135619988-135620010 TAGGGGGAGTAGGGGAAGAAGGG - Intergenic
1062438282 9:136556805-136556827 TGTGGGCTGTGGGGGAAGAAGGG - Intergenic
1062547938 9:137072103-137072125 TGAGGGGTGTGCTGGAAGCAGGG - Intergenic
1062695498 9:137873744-137873766 TGGAGGGTCCGGAGGAAGATGGG + Intergenic
1062713015 9:137986941-137986963 TGGGCCGTGTGGAGGAACAAGGG - Intronic
1203565601 Un_KI270744v1:84960-84982 TGGGGCTTGTGGAGAAAGACAGG - Intergenic
1203608540 Un_KI270748v1:76003-76025 AGGGGGGTGGAGAGGGAGAAAGG + Intergenic
1185563150 X:1076100-1076122 TAGGGGCTGGGGAGGAAGAAAGG + Intergenic
1185603691 X:1355227-1355249 TGGAGGGGGAGGAGGAAGGAGGG + Intronic
1185979170 X:4757251-4757273 GGGAGGCTGTGGCGGAAGAATGG - Intergenic
1186168792 X:6855682-6855704 TGGGGATAGTGGAGGAAGAATGG + Intergenic
1186267270 X:7844538-7844560 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186297720 X:8169113-8169135 TGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186325139 X:8467358-8467380 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186471352 X:9824559-9824581 TGTGGGGAGGGGAGGAAGAGAGG - Intronic
1186526783 X:10256110-10256132 TTGGGGGTGTGGAGGAGTAGAGG - Intergenic
1186591017 X:10930210-10930232 TGGGGGGTGTGCACAAAAAATGG - Intergenic
1186832972 X:13408955-13408977 TGGGGGGTGGGGAGAAAGGGGGG + Intergenic
1186900601 X:14051284-14051306 TGGGGAGTGTGGTGGGTGAATGG + Intergenic
1187325740 X:18285550-18285572 GGGGGGGTGAGGAGGAGGAGAGG + Intronic
1187452825 X:19413682-19413704 GGGGGGGTGGGGAAGATGAAAGG + Intronic
1187682248 X:21779108-21779130 TTGGGGGTATGAAGGAAGTAGGG - Intergenic
1187735847 X:22302945-22302967 AGAGGGGTGGGGAGGAAGTAGGG + Intergenic
1188776092 X:34220871-34220893 TGTAGGATGTGTAGGAAGAATGG + Intergenic
1188849210 X:35111232-35111254 TGGAGGGTTTGGAAGAAGACAGG - Intergenic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1189236689 X:39492444-39492466 TTGGGGGTGAGGATGAAGAGTGG + Intergenic
1189376701 X:40472292-40472314 TGGGGTGTGGGGAGGAGGAGGGG - Intergenic
1189482806 X:41406127-41406149 AGTGGCCTGTGGAGGAAGAAAGG - Intergenic
1189511970 X:41671982-41672004 TGGGCAGGGTGGAGAAAGAAAGG - Intronic
1189682953 X:43535701-43535723 TGGGGGGGGTGGCGGGAGTAGGG + Intergenic
1190387889 X:49900689-49900711 TGGGTGGTGAAGAGAAAGAAAGG + Intergenic
1191055218 X:56233413-56233435 TGGGGTGTGTGGGGGGAGCAGGG - Intronic
1191061273 X:56299488-56299510 TGGGGGTTCTGGAGCTAGAATGG - Intergenic
1192203851 X:69083283-69083305 GAGGGGTTGGGGAGGAAGAAGGG + Intergenic
1192213973 X:69145079-69145101 TGGGGGGTGAGGAGGAGGGAGGG + Intergenic
1192318622 X:70070574-70070596 TGGGGGAGGTGGAGGCGGAAGGG - Intergenic
1192488355 X:71550892-71550914 TTGGGGGGGTGGAGGAGGGATGG + Intronic
1193165903 X:78280089-78280111 TGGGGGGTGGGGAGGATTCAGGG - Intronic
1193839742 X:86395528-86395550 TGGGGTGGGGGGAGGAAGGAAGG - Intronic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194524128 X:94956620-94956642 TGGGGAGTGGGGATGAAGAGAGG + Intergenic
1195042776 X:101029454-101029476 TGTGGGGGCTGGAGGAAGTATGG - Intronic
1195107801 X:101617380-101617402 GAGTGGGTGTGGAGAAAGAAGGG + Intronic
1195272272 X:103243344-103243366 GGTGGGGTGAGGAGGAAGAGTGG - Intergenic
1195283059 X:103356374-103356396 TGGGGGGCGGGGAGGGAGAGAGG + Intergenic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195379346 X:104256049-104256071 GGGAGGGGGAGGAGGAAGAAGGG - Intergenic
1196147369 X:112332681-112332703 TGGGGTGGGGGGAGGGAGAAGGG + Intergenic
1196196347 X:112841415-112841437 GCGGGGGAGCGGAGGAAGAAAGG - Intergenic
1196281626 X:113829400-113829422 AGAGGAGTCTGGAGGAAGAAGGG - Intergenic
1196631906 X:117951079-117951101 TGGGAAGTGTGGAGAAAGAGAGG - Intronic
1196711037 X:118763022-118763044 TGGGGGCTGTGGTGGGAGGAGGG + Intronic
1196900284 X:120375760-120375782 TTGGGGGTGAGGGAGAAGAATGG - Intronic
1197693164 X:129523584-129523606 GGGGGGGGGTGGAGGAAGGGGGG - Intergenic
1197874692 X:131090293-131090315 TGGGGGGTGAGGTGGAATAAAGG + Intergenic
1198110968 X:133502359-133502381 TGGGGAGTGGGGAGAAAGACAGG - Intergenic
1198152658 X:133926267-133926289 TACGGAGTTTGGAGGAAGAAAGG - Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1198533110 X:137564123-137564145 GGGGGGGGGGGGGGGAAGAAAGG + Intergenic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199411476 X:147528617-147528639 TGGGGGGGGAGGAGGAGGGAGGG - Intergenic
1199590354 X:149462165-149462187 TGGGGTGTCTGGAGGAAGGAAGG - Intergenic
1199682633 X:150237708-150237730 TGGGGGGTGTGGATGTATATGGG - Intergenic
1199703403 X:150402922-150402944 TGGGGTGGGGGGAGGAAGGAGGG + Intronic
1200250832 X:154552912-154552934 GAGGGGGTGAGGGGGAAGAATGG - Intronic
1200304249 X:155008447-155008469 GAGGGGGTGAGGGGGAAGAATGG + Intronic
1200342456 X:155411792-155411814 TGGTGGGTGTGGTGGAAATAGGG + Intergenic
1200693089 Y:6328595-6328617 TGGGGTGGGTGGAGGAGGTAGGG - Intergenic
1200926210 Y:8657315-8657337 GGGGGGCTGAGGAAGAAGAATGG - Intergenic
1201042183 Y:9846131-9846153 TGGGGTGGGTGGAGGAGGTAGGG + Intergenic
1201157837 Y:11149508-11149530 TGGGGCTTGTGGAGAAAGACAGG + Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201625707 Y:16012245-16012267 AGGAGGGAGGGGAGGAAGAACGG + Intergenic
1201919029 Y:19214096-19214118 TGGGGTGGGTGGAGGAGGGAGGG - Intergenic