ID: 1023737625

View in Genome Browser
Species Human (GRCh38)
Location 7:43248766-43248788
Sequence GAGGGGAAACAGGAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2152
Summary {0: 1, 1: 1, 2: 23, 3: 262, 4: 1865}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023737625_1023737639 12 Left 1023737625 7:43248766-43248788 CCGTTCTCCTCCTGTTTCCCCTC 0: 1
1: 1
2: 23
3: 262
4: 1865
Right 1023737639 7:43248801-43248823 GTTTTCAGGGTCGGAGTCCTAGG No data
1023737625_1023737637 3 Left 1023737625 7:43248766-43248788 CCGTTCTCCTCCTGTTTCCCCTC 0: 1
1: 1
2: 23
3: 262
4: 1865
Right 1023737637 7:43248792-43248814 CTCCTCATAGTTTTCAGGGTCGG No data
1023737625_1023737633 -1 Left 1023737625 7:43248766-43248788 CCGTTCTCCTCCTGTTTCCCCTC 0: 1
1: 1
2: 23
3: 262
4: 1865
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737625_1023737631 -2 Left 1023737625 7:43248766-43248788 CCGTTCTCCTCCTGTTTCCCCTC 0: 1
1: 1
2: 23
3: 262
4: 1865
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023737625 Original CRISPR GAGGGGAAACAGGAGGAGAA CGG (reversed) Intronic
Too many off-targets to display for this crispr