ID: 1023737631

View in Genome Browser
Species Human (GRCh38)
Location 7:43248787-43248809
Sequence TCCCCCTCCTCATAGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023737617_1023737631 16 Left 1023737617 7:43248748-43248770 CCCTCTTCCCCCATCTCCCCGTT 0: 1
1: 0
2: 2
3: 66
4: 695
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737616_1023737631 21 Left 1023737616 7:43248743-43248765 CCTGTCCCTCTTCCCCCATCTCC 0: 1
1: 1
2: 7
3: 211
4: 1759
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737620_1023737631 8 Left 1023737620 7:43248756-43248778 CCCCATCTCCCCGTTCTCCTCCT 0: 1
1: 1
2: 11
3: 142
4: 1165
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737622_1023737631 6 Left 1023737622 7:43248758-43248780 CCATCTCCCCGTTCTCCTCCTGT 0: 1
1: 1
2: 7
3: 105
4: 1304
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737621_1023737631 7 Left 1023737621 7:43248757-43248779 CCCATCTCCCCGTTCTCCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 534
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737626_1023737631 -9 Left 1023737626 7:43248773-43248795 CCTCCTGTTTCCCCTCCCCCTCC 0: 1
1: 1
2: 49
3: 577
4: 4075
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737625_1023737631 -2 Left 1023737625 7:43248766-43248788 CCGTTCTCCTCCTGTTTCCCCTC 0: 1
1: 1
2: 23
3: 262
4: 1865
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737624_1023737631 -1 Left 1023737624 7:43248765-43248787 CCCGTTCTCCTCCTGTTTCCCCT 0: 1
1: 0
2: 7
3: 95
4: 884
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737614_1023737631 30 Left 1023737614 7:43248734-43248756 CCTCCTTCTCCTGTCCCTCTTCC 0: 1
1: 1
2: 50
3: 627
4: 4182
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737618_1023737631 15 Left 1023737618 7:43248749-43248771 CCTCTTCCCCCATCTCCCCGTTC 0: 1
1: 0
2: 5
3: 98
4: 912
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737623_1023737631 0 Left 1023737623 7:43248764-43248786 CCCCGTTCTCCTCCTGTTTCCCC 0: 1
1: 0
2: 11
3: 84
4: 1066
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737619_1023737631 9 Left 1023737619 7:43248755-43248777 CCCCCATCTCCCCGTTCTCCTCC 0: 1
1: 0
2: 12
3: 294
4: 2460
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data
1023737615_1023737631 27 Left 1023737615 7:43248737-43248759 CCTTCTCCTGTCCCTCTTCCCCC 0: 1
1: 3
2: 30
3: 336
4: 2913
Right 1023737631 7:43248787-43248809 TCCCCCTCCTCATAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023737631 Original CRISPR TCCCCCTCCTCATAGTTTTC AGG Intronic
No off target data available for this crispr