ID: 1023737633

View in Genome Browser
Species Human (GRCh38)
Location 7:43248788-43248810
Sequence CCCCCTCCTCATAGTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 185}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023737619_1023737633 10 Left 1023737619 7:43248755-43248777 CCCCCATCTCCCCGTTCTCCTCC 0: 1
1: 0
2: 12
3: 294
4: 2460
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737616_1023737633 22 Left 1023737616 7:43248743-43248765 CCTGTCCCTCTTCCCCCATCTCC 0: 1
1: 1
2: 7
3: 211
4: 1759
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737624_1023737633 0 Left 1023737624 7:43248765-43248787 CCCGTTCTCCTCCTGTTTCCCCT 0: 1
1: 0
2: 7
3: 95
4: 884
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737615_1023737633 28 Left 1023737615 7:43248737-43248759 CCTTCTCCTGTCCCTCTTCCCCC 0: 1
1: 3
2: 30
3: 336
4: 2913
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737621_1023737633 8 Left 1023737621 7:43248757-43248779 CCCATCTCCCCGTTCTCCTCCTG 0: 1
1: 0
2: 4
3: 29
4: 534
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737625_1023737633 -1 Left 1023737625 7:43248766-43248788 CCGTTCTCCTCCTGTTTCCCCTC 0: 1
1: 1
2: 23
3: 262
4: 1865
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737623_1023737633 1 Left 1023737623 7:43248764-43248786 CCCCGTTCTCCTCCTGTTTCCCC 0: 1
1: 0
2: 11
3: 84
4: 1066
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737617_1023737633 17 Left 1023737617 7:43248748-43248770 CCCTCTTCCCCCATCTCCCCGTT 0: 1
1: 0
2: 2
3: 66
4: 695
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737622_1023737633 7 Left 1023737622 7:43248758-43248780 CCATCTCCCCGTTCTCCTCCTGT 0: 1
1: 1
2: 7
3: 105
4: 1304
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737620_1023737633 9 Left 1023737620 7:43248756-43248778 CCCCATCTCCCCGTTCTCCTCCT 0: 1
1: 1
2: 11
3: 142
4: 1165
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737618_1023737633 16 Left 1023737618 7:43248749-43248771 CCTCTTCCCCCATCTCCCCGTTC 0: 1
1: 0
2: 5
3: 98
4: 912
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185
1023737626_1023737633 -8 Left 1023737626 7:43248773-43248795 CCTCCTGTTTCCCCTCCCCCTCC 0: 1
1: 1
2: 49
3: 577
4: 4075
Right 1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023737633 Original CRISPR CCCCCTCCTCATAGTTTTCA GGG Intronic
900726350 1:4218799-4218821 CCCCCTCCTCTCAGCTTTCTGGG + Intergenic
906248358 1:44292894-44292916 CCCCCTCCCCAAACTTGTCATGG + Intronic
908231380 1:62108451-62108473 CCCCTTCTTCATAGACTTCATGG - Exonic
912702156 1:111886402-111886424 CCTCTTCCCCATATTTTTCATGG - Intronic
914799662 1:150951233-150951255 TCCCTACCTCATAGCTTTCATGG - Intronic
918300037 1:183195161-183195183 CCCCCTCCTCATTGTCTGCCTGG + Intronic
919247969 1:195013818-195013840 CCCCCTCCTAGCTGTTTTCATGG + Intergenic
919371873 1:196738673-196738695 CCCCCTCCTGGTTGCTTTCATGG + Intronic
922602096 1:226864255-226864277 CACCGTCCTCATGGTCTTCATGG + Intergenic
923426032 1:233870623-233870645 CCCCCTCCTCTTTTTTTTCATGG - Intergenic
923754490 1:236778382-236778404 CCCACTCCTCAGAGATTGCAAGG - Intergenic
924244355 1:242068045-242068067 CCCCCTCTTCAACGTTTTGAAGG + Intergenic
924446468 1:244137258-244137280 CCCCATCCTAATAGTATTAATGG + Intergenic
1063659814 10:8027194-8027216 CGCCCTCCTCTCTGTTTTCAAGG + Intergenic
1064974024 10:21094878-21094900 CCCTCTCGTCATAGTTTCCCAGG + Intronic
1066560278 10:36662587-36662609 TCTGCTCCGCATAGTTTTCAGGG + Intergenic
1068221596 10:54052300-54052322 CCCCCTCCTAACTGCTTTCATGG - Intronic
1068222002 10:54057088-54057110 CCCACTCCTGGTTGTTTTCATGG + Intronic
1071915299 10:90288717-90288739 CCCCCTGGTCAGAGTTTTCCTGG - Intergenic
1077827518 11:5826821-5826843 CCCCCTCCTGGCTGTTTTCATGG - Intronic
1081559239 11:44197665-44197687 TCCCCTCCTCAAAATTTGCATGG - Intronic
1082747667 11:56983796-56983818 CCCTCTTTTCCTAGTTTTCAGGG + Intergenic
1084908960 11:72372247-72372269 CCTCCTCCTCATATTCTTAACGG - Intronic
1086323211 11:85671790-85671812 CCCCCTCCTGGCAGCTTTCATGG + Intronic
1087230276 11:95653562-95653584 CCCTCCCCTCATAGAGTTCATGG + Intergenic
1087578836 11:100025581-100025603 CCCCCTCCCAGTTGTTTTCATGG - Intronic
1087729996 11:101767968-101767990 CCCCCTCCTGACTGCTTTCACGG + Intronic
1089606320 11:119643633-119643655 CCCCTTCCTCACAGCTGTCAAGG - Intronic
1090982996 11:131739868-131739890 CCCCTTGCTCATGGTTTTCCAGG - Intronic
1097310809 12:58117219-58117241 CAACTTCCTCATAGTGTTCATGG - Intergenic
1098457533 12:70691867-70691889 CATCCTCCTCATAGCTGTCAAGG + Intronic
1098627387 12:72689186-72689208 CTGCCTCCTAATAGTTCTCAAGG - Intergenic
1100357820 12:93848693-93848715 GCTCCTCCTCCTAGTGTTCAGGG + Intronic
1103416601 12:120745897-120745919 AACCCATCTCATAGTTTTCATGG + Intergenic
1103645477 12:122389000-122389022 TCCCCTCCTCCATGTTTTCAAGG + Intronic
1104085294 12:125469250-125469272 CCCTCTACTCCTAGTTCTCAAGG + Intronic
1104201107 12:126590188-126590210 ACCCCTCCTCATAGTCCTCTGGG + Intergenic
1104440031 12:128786883-128786905 TCCCCTCCACATAGGTTTCTTGG - Intergenic
1105464766 13:20628417-20628439 CCTTTTCCTCATTGTTTTCAGGG + Intronic
1107578327 13:41752055-41752077 CACCCTCCACATAGTTATAAAGG + Intronic
1108507701 13:51127594-51127616 CCCCCACCACCTAGATTTCATGG - Intergenic
1110359706 13:74611063-74611085 CCCCCTCCTGGCTGTTTTCATGG - Intergenic
1111372099 13:87332846-87332868 CTCCCTCCTGGTTGTTTTCATGG + Intergenic
1111524546 13:89451757-89451779 GCACCTTCTCATAGTTCTCAAGG + Intergenic
1111601578 13:90481578-90481600 CCCCCTCCTGGCTGTTTTCATGG + Intergenic
1112590959 13:100762723-100762745 CCTCCGCCTCCTAGTGTTCAAGG + Intergenic
1114876793 14:26730431-26730453 CCCCCTCCACCTGCTTTTCATGG + Intergenic
1115995151 14:39188396-39188418 CACCCTCCTCAGACTTTTAAAGG - Intergenic
1116841627 14:49824245-49824267 CCGCCTCCTCAGACTTTTAAAGG - Intronic
1117372801 14:55094157-55094179 CTCCATCCCCATAGTTTTTATGG - Intergenic
1118046457 14:61976229-61976251 CCCCCTCCTGGTTGCTTTCATGG + Intergenic
1118860307 14:69657903-69657925 CCCCCGTCTCATCTTTTTCAGGG + Intronic
1124067807 15:26362420-26362442 CCCTCTCCCCTTAGTTTTTATGG - Intergenic
1126956013 15:53934690-53934712 CTCATTTCTCATAGTTTTCAAGG + Intergenic
1127664725 15:61134480-61134502 CACCCTCCTCAATGTTTTCCAGG - Intronic
1127886111 15:63202324-63202346 CCCACTCAACATACTTTTCAAGG - Intronic
1129206467 15:74039999-74040021 CCCCTTCCTCATAGATTTCACGG - Intronic
1133567266 16:7007764-7007786 CCCCATCCTCACAGTTTCTAAGG - Intronic
1134102827 16:11464499-11464521 CCCCCTCCTGCTAGTGTGCAGGG - Intronic
1134749346 16:16613578-16613600 CCCCCTTCTCATCCTTTTCCAGG - Intergenic
1134996125 16:18740045-18740067 CCCCCTTCTCATCCTTTTCCAGG + Intergenic
1136843940 16:33560960-33560982 CCCCCTCATGATATTTTCCATGG - Intergenic
1138659556 16:58509211-58509233 CCCCCTCCCCATAGATGTAAGGG - Intronic
1138948916 16:61886790-61886812 CCACATCCTCCTAGTTTTCCTGG + Intronic
1139418358 16:66832237-66832259 CCCCCTCCCAATTGTTCTCATGG - Intronic
1139696140 16:68676371-68676393 CCCCTTCCCCACAGTATTCATGG + Exonic
1203154105 16_KI270728v1_random:1861259-1861281 CCCCCTCATGATATTTTCCATGG - Intergenic
1146475333 17:33158019-33158041 TCCCATCCTCGTGGTTTTCAGGG + Intronic
1147949900 17:44101456-44101478 TCCCCTCCTCCTAGCTTTCTGGG - Intronic
1150597472 17:66618947-66618969 CCCCCTCCTCATCTATTTCCTGG - Intronic
1152724643 17:81939247-81939269 CCCCTTCCTCACATTCTTCATGG + Intronic
1157240190 18:46002058-46002080 CCACTTCCTCATAGTCTCCATGG + Intronic
1158884541 18:61814316-61814338 CACCCTCCTCACCATTTTCAGGG + Exonic
1162011460 19:7818217-7818239 TCCCCACCTCCTAGTATTCATGG - Intergenic
1163364273 19:16867525-16867547 CCACCTCCTCAGAGTGTCCAAGG - Intronic
1164072438 19:21780586-21780608 TCCCTTCCTCCTAGTTCTCATGG - Intergenic
1166888693 19:45976537-45976559 CCCCCACCCCAGAGCTTTCAGGG + Intergenic
1167226880 19:48250455-48250477 CCCCCTCTTCATGGCTTTCCTGG + Intronic
926868502 2:17386463-17386485 CCCCAACCTCATCCTTTTCAGGG - Intergenic
927137180 2:20105517-20105539 CCCACTCCTCATTGCTCTCAGGG + Intergenic
929750977 2:44713351-44713373 CACCCTCCTTAGAGTTTCCATGG - Intronic
932419967 2:71595898-71595920 CTCCCTCCTCTTAGCTTTCCTGG + Intronic
935542317 2:104363049-104363071 CCACCTCCGGATAGCTTTCATGG - Intergenic
937467764 2:122149692-122149714 CCCCCTCCCCATGGATATCAAGG - Intergenic
938125329 2:128666968-128666990 CCTCCTCACCATTGTTTTCATGG + Intergenic
938385714 2:130865501-130865523 CCTCCTCCTCCTAGTCATCATGG + Intronic
940764306 2:157773099-157773121 CACCCTCCTCCTAGTGCTCATGG - Intronic
942172343 2:173300480-173300502 CCCCATCCTCCTAGTGTGCATGG + Intergenic
945705438 2:213225192-213225214 CTCCCTCCTCAGAGATTTAACGG - Intergenic
945894487 2:215466808-215466830 ACCCCTCCTCCCAGTCTTCAAGG - Intergenic
947394980 2:229677396-229677418 TCCCATCATCATAGATTTCAAGG + Intronic
947466944 2:230359579-230359601 CCCCATAGTCATAGCTTTCAGGG + Intronic
1169547783 20:6668293-6668315 ATCCCTCCCCATAGTTTTAATGG - Intergenic
1173349500 20:42232281-42232303 TACCCTCCTCATAGGTATCAGGG - Intronic
1175221410 20:57418980-57419002 CCCCTTCCTCTTACTTTACAGGG + Intergenic
1175549206 20:59805793-59805815 CCCCCTACTCATGGGTTTCCAGG - Intronic
1176029680 20:63005940-63005962 CCCCCTCCTCCTGGTCTGCAGGG + Exonic
1176263479 20:64195899-64195921 TCTCCTCCCCACAGTTTTCATGG + Intronic
1178678641 21:34652977-34652999 CCCCCACATCACAGTTCTCATGG - Intergenic
1178761172 21:35404273-35404295 CCCCTTCCTCATAATTTTTCTGG + Intronic
1181545749 22:23601419-23601441 CCCACTCAGCATAGTTTTCTGGG - Intergenic
1181801006 22:25347824-25347846 CCCACTCAGCATAGTTTTCTGGG + Intergenic
1181814519 22:25428185-25428207 CCCACTCAGCATAGTTTTCTGGG + Intergenic
1181970416 22:26685607-26685629 CAACCACATCATAGTTTTCAAGG + Intergenic
1182159563 22:28107885-28107907 CTGCCTCCTGATAGTTTCCAAGG + Exonic
1182751693 22:32646664-32646686 ACCCTTACTCATAGTTTGCAGGG - Intronic
1182990762 22:34765301-34765323 CTCCCTCCTCTGAGTTCTCATGG - Intergenic
1183044422 22:35208269-35208291 CTACCTCCTCCTAGATTTCAAGG - Intergenic
951126972 3:18995922-18995944 CCCCCTCCTGGCTGTTTTCATGG + Intergenic
953922283 3:46960460-46960482 CCCCCCTCCCATTGTTTTCAGGG - Intronic
955025776 3:55165992-55166014 CCCTCTCCTTCTAGTTTTCCTGG - Intergenic
955364957 3:58302998-58303020 CCCCCATATCATATTTTTCAGGG + Intergenic
955680153 3:61491807-61491829 CCCCCTCCTCTCATTTTTAAGGG - Intergenic
956503310 3:69910527-69910549 CTCCCTCCTGACTGTTTTCATGG - Intronic
956940232 3:74151919-74151941 CACTCTCCTGATAGTTTTCTTGG - Intergenic
959156354 3:102671101-102671123 CCCTCTCCCCATAGATCTCATGG + Intergenic
959172468 3:102859811-102859833 CCCCCTCCTGACTGCTTTCATGG + Intergenic
959368244 3:105490800-105490822 CCCCCTCCTAACTGCTTTCATGG + Intronic
959584563 3:108014141-108014163 CACCATCATCATAATTTTCAGGG + Intergenic
960206516 3:114907497-114907519 CCCCATCCCCATACTTCTCAGGG + Intronic
961965633 3:130899402-130899424 TCTCCTCCTCATAATTTTCTTGG - Intronic
962176810 3:133163678-133163700 CCCTCTCTCCATAGTCTTCAAGG - Intronic
964284424 3:155101993-155102015 CCCCCTCCTAATAGGTGTGATGG - Intronic
965466245 3:169034072-169034094 CCAACTCCTCATAACTTTCATGG - Intergenic
966115747 3:176458584-176458606 CTCCCTCCCCATGGCTTTCATGG - Intergenic
970336315 4:15047884-15047906 CCTCCTACTCCTAGTTTTCTGGG + Intronic
971229554 4:24789950-24789972 CCACCTCCTCATAGTGTTCCTGG - Intronic
972589144 4:40467632-40467654 CCCCCAAATCATATTTTTCATGG - Intronic
973183000 4:47291574-47291596 CCCCCTCCTAGTTGCTTTCATGG - Intronic
979103431 4:116653015-116653037 CCCCCACCCCTTGGTTTTCATGG - Intergenic
980783390 4:137521139-137521161 CATCTTCCTCATAATTTTCAGGG + Exonic
982241971 4:153308880-153308902 CTCCCTCCTCATATATTTTAGGG - Intronic
983048103 4:163011050-163011072 CCCCCTCCTTATTGCTTTTATGG + Intergenic
985845657 5:2345005-2345027 CTTCCTCCTCATTCTTTTCAGGG + Intergenic
986461596 5:7978412-7978434 CCTGCTCCTCAAAGTGTTCATGG - Intergenic
987511632 5:18847433-18847455 CCCCCTCCTGGCTGTTTTCATGG + Intergenic
989224611 5:39011561-39011583 CCCCCTCCTGACTGCTTTCATGG - Intronic
989564443 5:42887876-42887898 TCCCCTTCTTATCGTTTTCAAGG - Intergenic
991335322 5:65540556-65540578 CTCCCTTCCCAGAGTTTTCAGGG - Intronic
995283236 5:110358246-110358268 CCCCCTCCTGACTGCTTTCATGG - Intronic
995421186 5:111968863-111968885 ACCCCTCAGCATGGTTTTCAAGG + Intronic
995896099 5:117012704-117012726 CACTCTCCCCATAGTTTTCAGGG + Intergenic
997068624 5:130592961-130592983 CCACCTCCACATTATTTTCAAGG - Intergenic
997360884 5:133294123-133294145 CACCCTCCTCTCAGTTTCCATGG + Intronic
998634471 5:143937793-143937815 CCCCATCCTTAGAGTTTTCAGGG - Intergenic
999782106 5:154858093-154858115 CCCCCTCCTCCTGGCTTTGAAGG - Intronic
1000837038 5:166167828-166167850 CCCCTTGCTAATATTTTTCAGGG - Intergenic
1001063017 5:168510427-168510449 CCCTCTCTTAATAGTTCTCAGGG + Intronic
1002944543 6:1749008-1749030 CCCCCTCCTAAGATTCTTCAGGG - Intronic
1004318586 6:14614212-14614234 CCCCCTCCACATAATTGTCCTGG + Intergenic
1007253715 6:40513934-40513956 CCCCCTCCTGATAGCTCTCCAGG - Intronic
1008145333 6:47884901-47884923 CTACCTCTTCATAGTTTACAGGG - Intronic
1009305570 6:62085317-62085339 CTCACTCCACATATTTTTCATGG - Intronic
1013947278 6:115736275-115736297 CCCCCTCCTGGCTGTTTTCATGG - Intergenic
1014621643 6:123674692-123674714 CCCCCTCCTCGCTGTTTTCATGG + Intergenic
1014702103 6:124702559-124702581 CCCCCTCCTCTACGTTTTCTTGG - Intronic
1017100610 6:150846777-150846799 GCCTCTCCACATAGTTCTCATGG + Intergenic
1017248612 6:152255797-152255819 CCCCATCCTGATATTTTTCCTGG - Intronic
1018693085 6:166364810-166364832 AGCCATCTTCATAGTTTTCAAGG + Intergenic
1023088192 7:36593441-36593463 TGCCCTCCTCACAGTTCTCATGG + Intronic
1023737633 7:43248788-43248810 CCCCCTCCTCATAGTTTTCAGGG + Intronic
1024343946 7:48293818-48293840 CCCCCACCTCTAAGATTTCATGG - Intronic
1028301386 7:89205693-89205715 CCCCCTCCTGGCTGTTTTCATGG + Intronic
1029035626 7:97518168-97518190 CCCCATCTTCATAGTCTGCAAGG - Intergenic
1030366679 7:108654759-108654781 CCCCGTCCTCATCCTTGTCATGG + Intergenic
1031715893 7:125108665-125108687 CCCCCTCCTCGTTGCTTTCATGG + Intergenic
1037564217 8:20103837-20103859 CCCACTCCTCAAAGTGATCATGG + Intergenic
1039530365 8:38256182-38256204 CCCACTCCTCCTAATTTCCAGGG + Intronic
1040814325 8:51491661-51491683 TCCCATCTTCACAGTTTTCAGGG + Intronic
1042581273 8:70281586-70281608 CCCCCACCTCTTTGTTTTCTTGG + Intronic
1043296317 8:78667050-78667072 CCCCCGTCTCCTAGTTTACACGG + Intronic
1044051781 8:87514981-87515003 CCCTCTCATCATAGGCTTCAGGG + Intronic
1044252224 8:90017208-90017230 CTACCACCTAATAGTTTTCAAGG + Exonic
1044258008 8:90088609-90088631 CCCCCACCTCATTTTTTTTAAGG + Intronic
1045110677 8:98937130-98937152 CCCCATCCTCATAGTTTTTTGGG - Intronic
1045615332 8:103902430-103902452 TCCCCACCTCATGGTATTCATGG - Intronic
1047187945 8:122652355-122652377 CCACCCTCTCCTAGTTTTCAGGG + Intergenic
1048041756 8:130736745-130736767 ATCCCTCCTCATAGTTTTTTGGG - Intergenic
1048569584 8:135640506-135640528 CCCTCTCCTGATAGGTGTCAAGG - Intronic
1050390022 9:5132911-5132933 AGCCCTAATCATAGTTTTCAGGG + Intronic
1052220590 9:26017353-26017375 CTCCCTCCTGACTGTTTTCATGG + Intergenic
1052680871 9:31690716-31690738 CACCTTCCTCTTGGTTTTCAGGG - Intergenic
1053572002 9:39319117-39319139 CCCCCTCCTGGTTGCTTTCATGG - Intergenic
1054125143 9:61299894-61299916 CCCCCTCCTGGTTGCTTTCATGG + Intergenic
1056411059 9:86327636-86327658 CCTCCTCCTCCCAGTGTTCAAGG + Intronic
1056792266 9:89633528-89633550 CCCCATCCTCATGGTTATCCTGG - Intergenic
1057139775 9:92719378-92719400 CCCCATCCTCATGGCTGTCACGG + Exonic
1061637297 9:131920707-131920729 CCCATTCCTCCTAGTCTTCAAGG - Intronic
1062584826 9:137244524-137244546 CCCCCTCCTCAGGCTTCTCAGGG + Intronic
1186704910 X:12130687-12130709 CACCCTCATAATAGTCTTCAAGG + Intergenic
1193580910 X:83261439-83261461 CACTCTCCTCATCTTTTTCAGGG - Intergenic
1198767523 X:140094279-140094301 CCTCCTCCTCATATTTTTTCAGG - Intergenic
1199563457 X:149188545-149188567 CCTCCTCCTCAAAGTTTTCATGG - Intergenic
1199908706 X:152261690-152261712 CCCCCTCCCAGTTGTTTTCATGG + Intronic
1200229712 X:154437778-154437800 CCGCCTCCTCATCGTCTTCTGGG + Intronic