ID: 1023737714

View in Genome Browser
Species Human (GRCh38)
Location 7:43249157-43249179
Sequence GCGGAGCCTTGGCTGCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 202}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023737709_1023737714 1 Left 1023737709 7:43249133-43249155 CCTCCATCAGAACTCGGGTCATC 0: 1
1: 0
2: 2
3: 5
4: 60
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737703_1023737714 10 Left 1023737703 7:43249124-43249146 CCGTCCCCACCTCCATCAGAACT 0: 1
1: 1
2: 6
3: 80
4: 785
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737702_1023737714 11 Left 1023737702 7:43249123-43249145 CCCGTCCCCACCTCCATCAGAAC 0: 1
1: 0
2: 2
3: 50
4: 574
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737710_1023737714 -2 Left 1023737710 7:43249136-43249158 CCATCAGAACTCGGGTCATCTGC 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737700_1023737714 21 Left 1023737700 7:43249113-43249135 CCGGGCGCCGCCCGTCCCCACCT 0: 1
1: 0
2: 3
3: 29
4: 365
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737707_1023737714 5 Left 1023737707 7:43249129-43249151 CCCACCTCCATCAGAACTCGGGT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737705_1023737714 6 Left 1023737705 7:43249128-43249150 CCCCACCTCCATCAGAACTCGGG 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737701_1023737714 14 Left 1023737701 7:43249120-43249142 CCGCCCGTCCCCACCTCCATCAG 0: 1
1: 1
2: 9
3: 186
4: 2853
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737699_1023737714 29 Left 1023737699 7:43249105-43249127 CCTAGGTGCCGGGCGCCGCCCGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737698_1023737714 30 Left 1023737698 7:43249104-43249126 CCCTAGGTGCCGGGCGCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1023737708_1023737714 4 Left 1023737708 7:43249130-43249152 CCACCTCCATCAGAACTCGGGTC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023737714 Original CRISPR GCGGAGCCTTGGCTGCGGCC CGG Intronic