ID: 1023738044

View in Genome Browser
Species Human (GRCh38)
Location 7:43251934-43251956
Sequence CAAGCTGGACCCAGTGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023738039_1023738044 30 Left 1023738039 7:43251881-43251903 CCTGACAGGTAGGTGTAGAAATT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1023738044 7:43251934-43251956 CAAGCTGGACCCAGTGCTCTGGG 0: 1
1: 0
2: 3
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023738044 Original CRISPR CAAGCTGGACCCAGTGCTCT GGG Intronic
900176748 1:1294527-1294549 CGAGCTGCACCCGGGGCTCTTGG - Exonic
900829607 1:4956537-4956559 AAAGCTGGGCCCAGGGGTCTTGG - Intergenic
900910503 1:5594010-5594032 CAAGCTGGGCCTTGTGCACTGGG - Intergenic
900955793 1:5885567-5885589 CCAGCTGGGCCCAGGGCCCTGGG - Intronic
901017643 1:6241214-6241236 CAAGCAGGACAAAGTGCTCTCGG - Intergenic
901182762 1:7352802-7352824 CTAGCTGGACCCATGACTCTTGG + Intronic
901226104 1:7613811-7613833 CAAGCTGGACCCAGAGGAGTCGG + Intronic
902405691 1:16182172-16182194 CCGGCTGGACCCAGTGCTCGGGG + Intergenic
903214621 1:21836906-21836928 AACGCTGGCCCCAATGCTCTTGG + Exonic
903380184 1:22891202-22891224 CAAGCTGGAGCCAGACTTCTTGG - Intronic
904449306 1:30600746-30600768 CAAGCTGAACCCAGGTGTCTCGG - Intergenic
904471136 1:30737099-30737121 GAAGCTGGACCCTATCCTCTGGG + Intronic
905335511 1:37241872-37241894 CTAGCTGGCCCCTGTGCTCAGGG - Intergenic
905868244 1:41387938-41387960 CAGGCTAGGCCCAGCGCTCTTGG + Intergenic
906355060 1:45098239-45098261 CAGGCAGGAGCCACTGCTCTGGG + Intronic
909213780 1:72859087-72859109 CAAACAGGACCCAGTGTTTTTGG + Intergenic
910809133 1:91218344-91218366 CATGCTAGACCTAGAGCTCTGGG + Intergenic
912445405 1:109732264-109732286 AAGGCTGGACCCCGTGCTCCAGG + Intronic
912496847 1:110097442-110097464 CAACCTGACTCCAGTGCTCTGGG - Intergenic
915304734 1:154970762-154970784 CAGGCTGGACCCAGCGCTTCTGG + Intronic
915537986 1:156549045-156549067 CAGGCAGGAGCCACTGCTCTGGG - Intronic
916186484 1:162138588-162138610 CAAGCTGGAGCCAGAGGCCTGGG + Intronic
916637646 1:166690928-166690950 CAGGCTGGTCCCAGTACTTTGGG + Intergenic
916687011 1:167156656-167156678 CCAGCTGGAGCCAGAGCTTTGGG + Intergenic
920088405 1:203434692-203434714 CAAAATGGTCCCAGTGCTCATGG - Intergenic
920163115 1:204015149-204015171 CAAGCGTGAGCCACTGCTCTCGG - Intergenic
920753218 1:208702569-208702591 CATGCTGGAGCCAGCTCTCTGGG - Intergenic
921357570 1:214300268-214300290 CAAGCTGGATCATGTGCTCTAGG - Intronic
922881580 1:228985177-228985199 CCAACTGGACCCCATGCTCTAGG - Intergenic
923942191 1:238840709-238840731 CATGCTGGTTCCAGTTCTCTCGG - Intergenic
924294967 1:242577327-242577349 CATGCTGGTGCCATTGCTCTTGG + Intergenic
924585046 1:245354625-245354647 CAAGGTGGACACAGTGCCCCTGG - Intronic
1064147002 10:12833547-12833569 CACGCTGGAACCATTGCTCTAGG + Exonic
1070533976 10:77361706-77361728 CCAACTGGAGCCAGTGCTCCTGG - Intronic
1070638105 10:78145465-78145487 CATGCTGGAGACAGTCCTCTGGG + Intergenic
1070821074 10:79354901-79354923 CAGGGTGGAGCCAGTGCTCATGG - Exonic
1070833453 10:79433905-79433927 CAAGCTGGCCCCAGGGCACAGGG + Intronic
1072370574 10:94762758-94762780 CAATCTGGAGACAGAGCTCTGGG + Exonic
1073180297 10:101579312-101579334 CGAGCAGGGCCCAGGGCTCTGGG - Exonic
1075073682 10:119336180-119336202 GAAGCTGGAGGCAGTGCTCTAGG - Intronic
1078005795 11:7531327-7531349 ATAGCTGGGCCCAGGGCTCTTGG + Intronic
1079485253 11:20929459-20929481 CACACTGCACCCATTGCTCTGGG + Intronic
1080421956 11:32118302-32118324 CATGAGGGACCCAGTGCTCCTGG + Intergenic
1081709055 11:45205382-45205404 CACGCTGGACCCATGGTTCTGGG - Intronic
1081861717 11:46336828-46336850 CAAGCATGACCCACTGCTCCTGG + Intronic
1083841634 11:65308228-65308250 AAAGCTGGACCCAGCCCTCAGGG - Intergenic
1083853569 11:65381087-65381109 CCAGCTGTCCCCAGTCCTCTGGG - Intronic
1085217843 11:74848124-74848146 GAAGATGGACTCTGTGCTCTTGG + Exonic
1086963592 11:93005539-93005561 CAAGCTGCTCCCAGTCCTCTGGG + Intergenic
1087107380 11:94423783-94423805 CAGGCTGGTCCCAGTGCTACAGG + Intronic
1089350743 11:117820336-117820358 CCAGCTGGCCCCAGTGCAGTGGG + Exonic
1089665534 11:120015841-120015863 CAAGTTGGACCTTTTGCTCTTGG - Intergenic
1090628994 11:128629857-128629879 CTATGTGGAACCAGTGCTCTTGG - Intergenic
1091167462 11:133492245-133492267 GAAGCAGGACCCAGTGCGGTGGG - Intronic
1091302306 11:134515352-134515374 CTTGGTGGACCCAGAGCTCTGGG - Intergenic
1092252548 12:6908203-6908225 CTCTCTGGACCCAGTCCTCTTGG + Intronic
1094631378 12:32178647-32178669 CAAGTTGGAGCCACTGCTCCGGG + Intronic
1095460830 12:42442955-42442977 CACGCTGGACCTAGAGCTTTGGG + Intronic
1095808261 12:46344604-46344626 CAGGCTGGAGCCACTGCTCCTGG + Intergenic
1096080510 12:48829368-48829390 CTAGTTGGACCCATTGCTCCTGG - Intergenic
1097261004 12:57720278-57720300 GCGGCTGGACCCAGTGCTGTCGG + Intronic
1097325523 12:58272096-58272118 TAAGCTGGACATAGTGCTTTCGG - Intergenic
1098613143 12:72486165-72486187 CAACCTGGACCCAGGGAACTGGG - Intronic
1099285663 12:80711442-80711464 CAAGCTGGGCTCAGTGGTATGGG - Intergenic
1101674256 12:106903406-106903428 CCAGCTGGACCATGGGCTCTCGG - Intergenic
1102053875 12:109881743-109881765 GAAGCTGGACCCTGGGCTGTTGG - Intergenic
1102055322 12:109892447-109892469 CAGGCTGGACACAGTGGTATGGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104169769 12:126268819-126268841 CAAGCTGGAGCCAGTCCTCTGGG - Intergenic
1105204308 13:18207349-18207371 CAGGCTGCACCCAGTCCTTTTGG - Intergenic
1107352550 13:39530943-39530965 CAAGCTGGAGGTAGTGATCTCGG - Intronic
1107710526 13:43146290-43146312 CAAGCTGGAGGCAGTGCTGCGGG + Intergenic
1108934320 13:55866996-55867018 CCAGCAGGACCCAGGGCTCTTGG - Intergenic
1111509431 13:89241907-89241929 CACTCTGAACCCAGTCCTCTTGG + Intergenic
1113259791 13:108549007-108549029 CAATCTGAACACAGTGCTGTGGG - Intergenic
1113413223 13:110108208-110108230 CAGGCTGGAACCTGTGGTCTCGG + Intergenic
1114337844 14:21711138-21711160 CAGGCTTGACCCACTGCTCCCGG + Intergenic
1117622028 14:57597318-57597340 CAAGATGGCCCCACTGCTATGGG - Intronic
1118710654 14:68516087-68516109 GAAGCTGGACCCATTTCTTTAGG + Intronic
1118935226 14:70282083-70282105 CTGGCTGGAACCAGAGCTCTGGG - Intergenic
1119074049 14:71618180-71618202 GAGGCAGGACCCAGGGCTCTGGG - Intronic
1120975462 14:90244318-90244340 CCAGCTGGACCCAATCCACTGGG + Intergenic
1122804678 14:104250420-104250442 CATGCAGGACCCAATGCTCAGGG - Intergenic
1122988105 14:105221886-105221908 CAAGCTGGACGCGGTGTCCTCGG + Exonic
1128371123 15:67040091-67040113 CACGCTGGCCACAGTGCTCATGG + Intergenic
1129516912 15:76162638-76162660 AAAACTGGACCTAGGGCTCTGGG + Intronic
1129797893 15:78391936-78391958 CAAGCAGGACCCAGAGCTTGGGG + Intergenic
1130796310 15:87213556-87213578 CATCCTGAACCCAGTGCTATTGG - Intergenic
1130955176 15:88622233-88622255 TAGCCTGGACCCAGCGCTCTGGG - Intronic
1131558914 15:93422719-93422741 AAGGCTGGACCCAGTCCTCGGGG - Intergenic
1132572954 16:651925-651947 CCAGCTGGGCCCAGGGCTCAAGG - Exonic
1133018036 16:2953935-2953957 CCAGCTGGGCCCATTCCTCTGGG - Intergenic
1135083001 16:19452348-19452370 CTACCTGAACCCAGTCCTCTTGG + Intronic
1137734189 16:50711960-50711982 CCAGCAGGCCCCAGTGCTCCCGG - Exonic
1137777541 16:51068955-51068977 CAGGCTGAAACCAGTCCTCTTGG + Intergenic
1138351615 16:56348948-56348970 CCAGCTGGACTCTGAGCTCTCGG + Intronic
1141080586 16:81048191-81048213 CAACCTGGACCCACTGCTCTAGG + Intergenic
1141168485 16:81676355-81676377 CAGGCCGTCCCCAGTGCTCTCGG + Intronic
1142715999 17:1747270-1747292 CAAGCTGTTCCCAGGGCTCCAGG - Intronic
1143774084 17:9186404-9186426 GAAGCTGGACCCAGGGCTCTGGG + Intronic
1143785136 17:9250078-9250100 ACAACTGGGCCCAGTGCTCTAGG + Intergenic
1144960172 17:19040246-19040268 CAAGCTGGAGCCAGTGCCCCAGG - Intronic
1144974988 17:19134278-19134300 CAAGCTGGAGCCAGTGCCCCAGG + Intronic
1147941041 17:44048202-44048224 CAAGCATGAGCCACTGCTCTTGG - Intronic
1149078774 17:52629627-52629649 CAGGCTGGTCCCAATGCCCTAGG + Intergenic
1151580753 17:74977034-74977056 CAGGCGTGACCCACTGCTCTTGG - Intergenic
1152643476 17:81458541-81458563 CACGCTGGCCCCTGAGCTCTGGG + Intronic
1153242264 18:3041769-3041791 GAAGCTGGACCAACTGCTCTGGG + Intergenic
1157938966 18:51905379-51905401 AAAGCTGGACCTAGTTCTCTTGG + Intergenic
1159647677 18:70938535-70938557 CATTCTGGACCAAGTTCTCTGGG + Intergenic
1163606787 19:18280233-18280255 CAAGCTGGACCCCCTGCTCCCGG - Exonic
1164258289 19:23548416-23548438 CATGCTGGACATAGAGCTCTGGG + Intronic
1164862223 19:31570829-31570851 CAAACAGGACACAGTGCACTGGG - Intergenic
1165472510 19:36011423-36011445 CAAAGTGGACCCAGCTCTCTGGG - Exonic
1166988171 19:46674742-46674764 CAAGCTAACCCCAGTTCTCTCGG - Intronic
1168333198 19:55581109-55581131 GTAGCTGGACCCAGTGTTCCAGG - Intergenic
925712411 2:6754212-6754234 AAAGCTGGACCCACTGCTTGAGG - Intergenic
931417614 2:62096537-62096559 CCAGCTGGACCCAATCCACTGGG - Intronic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
932390750 2:71388937-71388959 CATGCTGGACCTAGAGCTCTGGG + Intronic
932815304 2:74856325-74856347 CAGCCTGGACCCAGTGCTGAGGG + Intronic
932840135 2:75074164-75074186 CAAGCTGTAACCTGTGCTCCTGG + Intronic
934317739 2:91940791-91940813 TGAGCTGCACCCACTGCTCTGGG + Intergenic
936154473 2:110039396-110039418 TGAGCTGGACCCAGGGCTATAGG - Intergenic
936190209 2:110332018-110332040 TGAGCTGGACCCAGGGCTATAGG + Intergenic
937288945 2:120770343-120770365 GAAGCTGGGCCCCGTGCTCGGGG - Intronic
937299248 2:120828940-120828962 GAAGCTAGGCCCAGGGCTCTTGG + Intronic
937515804 2:122654148-122654170 CAAGCTTGAGCCACTGCTCCCGG + Intergenic
937680545 2:124640016-124640038 CAGGCTGGACCCTGAGCTCAGGG - Intronic
938763279 2:134443939-134443961 CAGGCAGGAGTCAGTGCTCTTGG + Intronic
939040399 2:137182209-137182231 CAAGTAGGACCCTGTGCTTTAGG + Intronic
946394481 2:219436241-219436263 GAGGCTGGGCCCAGTGCTCATGG + Intronic
947722424 2:232378176-232378198 GAATCTGGGCCCAGAGCTCTAGG - Intergenic
948188973 2:236044039-236044061 CACTCTGGAAACAGTGCTCTGGG - Intronic
1168859793 20:1037759-1037781 CAACCTTGAACCAATGCTCTGGG - Intergenic
1168952065 20:1809334-1809356 CATTCAGGACCCAGTGCTCTGGG - Intergenic
1169917370 20:10697005-10697027 CAAGCTGGACCCAGGCATCTTGG - Intergenic
1170116513 20:12865935-12865957 CAACCTGGAACCTGTCCTCTGGG + Intergenic
1172579237 20:36033817-36033839 GAAGCAGGACCCAGAGATCTTGG - Intergenic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1173137252 20:40449450-40449472 CAATCTGGAAACACTGCTCTAGG - Intergenic
1173919619 20:46733906-46733928 CCAGCTGGAACTTGTGCTCTGGG - Exonic
1173948044 20:46967277-46967299 CAAGCTGGAGCCACTGCACCTGG + Intronic
1179169780 21:38963842-38963864 CAGGCTGGATCCAGGGGTCTGGG - Intergenic
1179508957 21:41859623-41859645 CGAGCTGGGCCCAGTGGTCATGG - Exonic
1180305908 22:11124460-11124482 TGAGCTGCACCCACTGCTCTGGG + Intergenic
1180544427 22:16486643-16486665 TGAGCTGCACCCACTGCTCTGGG + Intergenic
1180787051 22:18553208-18553230 CCTGCAGGACCCAGAGCTCTGGG - Intergenic
1181069482 22:20323612-20323634 CAACCTGGAGCAAATGCTCTCGG - Intergenic
1181099350 22:20528964-20528986 CAGGCTGCACCAAGTGCTCTGGG - Intronic
1181234689 22:21442098-21442120 CCTGCAGGACCCAGAGCTCTGGG + Intronic
1181243960 22:21492733-21492755 CCTGCAGGACCCAGAGCTCTGGG - Intergenic
1181402703 22:22661029-22661051 CAGGCTGGACCCAGAGGCCTGGG - Intergenic
1181410084 22:22712499-22712521 CACGCTGGACCCAGAACCCTTGG - Intergenic
1181417635 22:22771913-22771935 CACACTGGACCCAGAGCCCTGGG - Intronic
1181430841 22:22880838-22880860 CAGGCTGGACCCAGAGCCCTGGG - Intronic
1182354412 22:29715931-29715953 CCAGCTGGACCCAGTGCAGCCGG + Intergenic
1183147551 22:36008537-36008559 CAAGCATGAGCCACTGCTCTTGG - Intronic
1183301226 22:37060113-37060135 CATCCTGGACCCAGTGCTGTGGG + Intronic
1183633853 22:39049221-39049243 CCAGCTGGAACCACAGCTCTGGG - Intronic
1183713161 22:39518608-39518630 CAGGCTGGAGCCACTGCTCCTGG + Intergenic
950360348 3:12445385-12445407 CACCCTGGGCCCAGTGCTCCAGG + Intergenic
950547260 3:13645927-13645949 TCAGCTGCTCCCAGTGCTCTGGG - Intergenic
950907427 3:16552096-16552118 CAAGCTGAACTCAGTCCTCGGGG - Intergenic
952144623 3:30518289-30518311 CATGGTGGACCCAGTGCTGAAGG + Intergenic
952181506 3:30921066-30921088 GCAGCTGGAGCCAGTGCTTTTGG - Intergenic
953169967 3:40498063-40498085 CAAGCAGCACCCAGGGATCTGGG - Intergenic
953457767 3:43056242-43056264 GCAGATGGACCCAGTGTTCTGGG + Exonic
953556409 3:43949901-43949923 CAATCTTGTCCCAGTGCTCTAGG - Intergenic
954648078 3:52143593-52143615 CCAGCTGGACCCAGGGATCTGGG - Intronic
955353297 3:58209809-58209831 GAATCTGGACCCAGGGCTCCTGG + Intronic
959773924 3:110134425-110134447 CAACCTGGCCCCAGTATTCTTGG - Intergenic
968483991 4:849996-850018 CACGCTGCACACAGTGCTGTGGG - Exonic
969884590 4:10204050-10204072 CACACTGGCCCCAGTGCTGTTGG - Intergenic
971428419 4:26538678-26538700 CATGCTGGACCCAGTACCATAGG + Intergenic
974181985 4:58395934-58395956 CAGGCTGGTCCTAGTGCACTTGG - Intergenic
974640586 4:64624823-64624845 CACGCTAGACCTAGAGCTCTGGG - Intergenic
975220149 4:71805090-71805112 CATGCTAGACCTAGAGCTCTGGG - Intergenic
975220720 4:71809605-71809627 CATGCTAGACCTAGAGCTCTGGG - Intergenic
977046654 4:92076646-92076668 CTCTCTGGACCCAGTCCTCTTGG - Intergenic
977950213 4:102962079-102962101 TGAGCTGCACCCACTGCTCTGGG + Intronic
980978245 4:139631677-139631699 CAAGCTGGGCCCCATTCTCTAGG + Intergenic
981207880 4:142065960-142065982 CTATCTGAACCCAGTTCTCTTGG + Intronic
982220718 4:153122885-153122907 CATTCTAGACCCAGTCCTCTTGG - Intergenic
982993907 4:162316941-162316963 CAACCTTGTCCCAGGGCTCTTGG + Intergenic
983819360 4:172173422-172173444 CAAGCTGCACCCTCTGGTCTAGG - Intronic
985776501 5:1846906-1846928 CAAGCTGGGCCCTCTGCTCGGGG - Intergenic
986305991 5:6517316-6517338 CAAGCTGCACCCAGGACTCAAGG - Intergenic
986917561 5:12640931-12640953 CAACCTTGACCCAATGCTGTTGG + Intergenic
991447055 5:66711555-66711577 CAAGCATGAGCCACTGCTCTGGG - Intronic
997585623 5:135041282-135041304 CAACTTGGACCCTGTGCTGTGGG + Intronic
998095990 5:139395732-139395754 CTGGCTGGACCCACTGCCCTCGG + Intergenic
998389940 5:141780777-141780799 CATCCTGGCCCCAGTACTCTAGG - Intergenic
999154740 5:149450282-149450304 CAAGCAGGCCCCATTGTTCTAGG - Intergenic
999614965 5:153413540-153413562 CTTGCTGGACTCAGTGCTCCTGG + Intergenic
1001268319 5:170291355-170291377 CAAATTGTACCCAGTGCACTAGG + Intronic
1002882082 6:1262082-1262104 CAATCTGGTCCCTGTGCTTTGGG + Intergenic
1003597876 6:7490602-7490624 CACTCTGGAGCCAGTGCCCTGGG + Intergenic
1004429299 6:15529535-15529557 CAGCGTGGACCCAGTGCCCTGGG - Intronic
1004791558 6:19032620-19032642 CAAGCCAGACCCATGGCTCTGGG + Intergenic
1004808508 6:19232014-19232036 CATTCTGGACCCAGGGTTCTTGG + Intergenic
1006280583 6:33050008-33050030 CATGCTAGACCTAGAGCTCTGGG + Intergenic
1007230381 6:40343939-40343961 CCAGCTGGACCCCAGGCTCTAGG + Intergenic
1007586055 6:42990100-42990122 CCAGCTGGGCCCACTGCCCTTGG + Intronic
1011786703 6:90854494-90854516 AACACTGGACCCAGTGCTCCTGG + Intergenic
1012278132 6:97298024-97298046 CAAGCTTGAGCCACTGCGCTGGG - Intergenic
1015296227 6:131596550-131596572 CATTCTGTAACCAGTGCTCTGGG + Exonic
1016863358 6:148743738-148743760 CAATCTGTGCCCCGTGCTCTTGG - Intergenic
1016891723 6:149014279-149014301 CAAGCTGGCCTGAGTGCTCCTGG - Intronic
1017211547 6:151862587-151862609 CAAGCTGGGCCAATTGCCCTTGG - Intronic
1017941961 6:159061091-159061113 CAAGCTGGATCCTGCCCTCTGGG - Intergenic
1018706519 6:166467601-166467623 CCAGCTGGAGCCAGTGCTTGGGG + Intronic
1019360198 7:600973-600995 CAAACTGAACCTGGTGCTCTTGG + Intronic
1020209490 7:6148058-6148080 CAAGCTTGAGCCACTGCGCTCGG - Intronic
1022681257 7:32548423-32548445 CAGGCTTGAGCCATTGCTCTTGG + Intronic
1023738044 7:43251934-43251956 CAAGCTGGACCCAGTGCTCTGGG + Intronic
1023926959 7:44676228-44676250 CTAGATGCACCCAGGGCTCTGGG - Intronic
1027544949 7:79515898-79515920 CATACTGATCCCAGTGCTCTTGG + Intergenic
1027701682 7:81478155-81478177 CAAGCAGGAGCCACTGCACTCGG - Intergenic
1029211144 7:98909330-98909352 CAAACTTGAACCAGTGCTGTAGG + Intronic
1029276055 7:99405009-99405031 CAAGCAGGACACAGCCCTCTGGG - Intronic
1029436223 7:100565421-100565443 CCAGGTGGCCCAAGTGCTCTTGG + Exonic
1030155238 7:106448251-106448273 CAAGATGGACCCAGTCCTTATGG + Intergenic
1031480271 7:122269677-122269699 CAAGCAGGACCCCCTGCCCTTGG - Intergenic
1032935666 7:136729034-136729056 GGAAGTGGACCCAGTGCTCTTGG + Intergenic
1034324224 7:150215805-150215827 CAAGCTGGAAAAAGTGCTCATGG + Intergenic
1034768970 7:153753431-153753453 CAAGCTGGAAAAAGTGCTCATGG - Intergenic
1036645693 8:10610578-10610600 CCAGCTGGACTCAGGCCTCTGGG - Exonic
1040457195 8:47610565-47610587 CTGGCTGCACCAAGTGCTCTGGG - Intronic
1042427519 8:68665494-68665516 TAAGCAGGATTCAGTGCTCTTGG - Intronic
1046862363 8:119107705-119107727 CAAGCTGTGCTCAGTGCACTAGG - Intergenic
1048813593 8:138310405-138310427 CAAGCTGGGAGCACTGCTCTTGG + Intronic
1048992457 8:139768884-139768906 CAAGATGGGCCCAATCCTCTCGG + Intronic
1048993083 8:139772793-139772815 CAAGATGGGCCCAATCCTCTCGG + Intronic
1049137952 8:140922590-140922612 CAAGATGGACTCAGTGTGCTTGG - Intronic
1049375960 8:142289322-142289344 CCAGCTGGACCCAGTCCTTGGGG + Intronic
1050692219 9:8240934-8240956 AAAGCTGGCCCAAATGCTCTAGG - Intergenic
1051207166 9:14700218-14700240 CAACCTGAACTCAGTGCTGTAGG - Intergenic
1051357565 9:16253747-16253769 CAGGCTGGGCTCTGTGCTCTGGG + Intronic
1051427473 9:16947791-16947813 CAATCTGTCTCCAGTGCTCTTGG + Intergenic
1055753660 9:79534257-79534279 CAAGCATGAGCCACTGCTCTGGG - Intergenic
1059178391 9:112188809-112188831 CAAACTGAACACAGTTCTCTGGG + Intergenic
1059766980 9:117392962-117392984 CAAGATGGACCAAGTGGTCATGG + Intronic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1061198333 9:129121054-129121076 CAGTCTGTGCCCAGTGCTCTGGG - Intronic
1061620566 9:131808850-131808872 TCAGCTGGACCCGGCGCTCTGGG - Intergenic
1061743622 9:132724363-132724385 AGACCTGAACCCAGTGCTCTGGG - Intergenic
1062588832 9:137263835-137263857 CAAGCAGCACCCAGGGTTCTGGG - Intronic
1185583952 X:1231376-1231398 CAGGCTGGAGCCACTGCACTTGG - Intergenic
1189095215 X:38131340-38131362 CAAGCTGGGCCCAGCAGTCTAGG - Intronic
1189204565 X:39226681-39226703 CAAGCTGGAGTCAGGGCTATGGG + Intergenic
1189231351 X:39454622-39454644 CAGGCTGGACCCAGTATTCCAGG + Intergenic
1190730390 X:53221965-53221987 CCAGCAGGAGCCAGGGCTCTGGG - Intronic
1192340518 X:70259793-70259815 CAAGCTGGACCAAGGGAGCTTGG - Intergenic
1193160058 X:78217608-78217630 CAGGCTAGACCTAGAGCTCTGGG - Intergenic
1195005710 X:100683413-100683435 CAAGCAGGAGCCACTGCACTTGG + Intronic
1195714420 X:107804802-107804824 CAGGCGGGAGCCACTGCTCTGGG - Intergenic
1200205839 X:154315612-154315634 CCATCTGAACCCAGGGCTCTGGG + Intronic