ID: 1023740385

View in Genome Browser
Species Human (GRCh38)
Location 7:43275747-43275769
Sequence ATTGTTGCAGGGAGTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023740385_1023740393 14 Left 1023740385 7:43275747-43275769 CCCCACTCACTCCCTGCAACAAT No data
Right 1023740393 7:43275784-43275806 ATTTGCTGGATAGGTGGCTGTGG No data
1023740385_1023740392 8 Left 1023740385 7:43275747-43275769 CCCCACTCACTCCCTGCAACAAT No data
Right 1023740392 7:43275778-43275800 TTGTTAATTTGCTGGATAGGTGG No data
1023740385_1023740391 5 Left 1023740385 7:43275747-43275769 CCCCACTCACTCCCTGCAACAAT No data
Right 1023740391 7:43275775-43275797 TCATTGTTAATTTGCTGGATAGG No data
1023740385_1023740390 0 Left 1023740385 7:43275747-43275769 CCCCACTCACTCCCTGCAACAAT No data
Right 1023740390 7:43275770-43275792 TTCAGTCATTGTTAATTTGCTGG No data
1023740385_1023740394 15 Left 1023740385 7:43275747-43275769 CCCCACTCACTCCCTGCAACAAT No data
Right 1023740394 7:43275785-43275807 TTTGCTGGATAGGTGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023740385 Original CRISPR ATTGTTGCAGGGAGTGAGTG GGG (reversed) Intronic