ID: 1023741142

View in Genome Browser
Species Human (GRCh38)
Location 7:43281768-43281790
Sequence AGGCTAGTCTCTTGTATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023741142 Original CRISPR AGGCTAGTCTCTTGTATTCC TGG Intronic
902397598 1:16140940-16140962 AGGCTGGTCTCTTGACCTCCTGG + Intronic
906938913 1:50238550-50238572 AGTGTGGGCTCTTGTATTCCAGG + Intergenic
907065635 1:51479854-51479876 AGGCTAGGATCTTGTAAACCAGG - Intronic
907242665 1:53089482-53089504 AGGCTGGGCTCTGGAATTCCTGG + Intronic
907935326 1:59036500-59036522 AGGCTAGTCACTTCTCTTGCTGG - Intergenic
909154123 1:72049111-72049133 AGGCTGGTGTCTTGAACTCCTGG - Intronic
911201522 1:95049369-95049391 AGGCTAATTTCTTGTATTTTTGG - Intronic
912673528 1:111653990-111654012 AGGCGAGTCTCTTGTTTTCATGG + Intronic
913592685 1:120343190-120343212 AGGCCACCCTCCTGTATTCCAGG - Intergenic
913650666 1:120911940-120911962 AGGCCACCCTCCTGTATTCCAGG + Intergenic
914170447 1:145217127-145217149 AGGCCACCCTCCTGTATTCCAGG - Intergenic
914525563 1:148461093-148461115 AGGCCACCCTCCTGTATTCCAGG - Intergenic
914598107 1:149174736-149174758 AGGCCACCCTCCTGTATTCCAGG + Intergenic
914640835 1:149606035-149606057 AGGCCACCCTCCTGTATTCCAGG + Intergenic
915161682 1:153924791-153924813 AGGCTGGTCTCATAAATTCCTGG + Intergenic
915707658 1:157861848-157861870 AGGCTGGTCTCTCGAACTCCTGG - Intronic
915831560 1:159135839-159135861 GGGCTTGGCTGTTGTATTCCAGG - Intronic
918422118 1:184374557-184374579 AGGAGAGTCTCTTGGATTCTAGG + Intergenic
919551075 1:198988550-198988572 AGACTAGACTCTGGTATGCCAGG - Intergenic
919804116 1:201370646-201370668 AGGCAAGTCTCGTCTATTCATGG + Intronic
920113292 1:203602059-203602081 AGGCTGGTCTCATGAACTCCTGG + Intergenic
920885603 1:209924971-209924993 AAGGTAGTCTCTTGTCTTCCTGG + Intergenic
922322392 1:224500220-224500242 AGACTGGTCTCTTGAACTCCTGG + Intronic
922507656 1:226135882-226135904 AGCCTCCTCTCTTGTAGTCCGGG - Intergenic
922543989 1:226441525-226441547 AGGCTAGTTTTTTGTATTTTTGG + Intergenic
922812399 1:228424802-228424824 AAGCTAGTCTCTTGGGTTTCGGG - Intergenic
1063229344 10:4048669-4048691 AGGCCAGTCTGATTTATTCCTGG + Intergenic
1064028637 10:11869468-11869490 AGGCTCCTCCCTTGTCTTCCAGG + Exonic
1064526860 10:16266156-16266178 AAGGCAGTCTCTTGTATTCAGGG + Intergenic
1066004312 10:31133192-31133214 AGTCTCGTTTCTTGTATCCCTGG + Intergenic
1066203181 10:33161317-33161339 AAGCTGGTCTCTTGTCTTCTAGG + Intergenic
1072226285 10:93373025-93373047 AGGCCAGTCTCTTCTCTCCCCGG + Exonic
1073572097 10:104589336-104589358 AGGAGAGTCTCTTATACTCCTGG + Intergenic
1074554242 10:114473901-114473923 AGGCCAGGCTCCAGTATTCCTGG - Exonic
1075752980 10:124789320-124789342 TGTCTATTCTGTTGTATTCCTGG - Intronic
1078270506 11:9790056-9790078 AGACCAGTCTGTTGCATTCCAGG + Intronic
1078776889 11:14402199-14402221 AGTCTAGTTTCTTGTATTGTTGG - Intergenic
1079000775 11:16753523-16753545 AGGCTAATTTTTTGTATTTCAGG + Intronic
1082616847 11:55371381-55371403 AGGCTTCTCTCTGGGATTCCAGG + Intergenic
1084897854 11:72288163-72288185 AGTCTGGTCTCATGTATTCTAGG + Intergenic
1086798132 11:91134878-91134900 AGGTCATTCTCTTGTATTACAGG + Intergenic
1087585171 11:100110014-100110036 AGGCTAATTTTTTGTATTTCTGG - Intronic
1087918888 11:103843568-103843590 ATTCTAGTCTCTTCTAATCCTGG - Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1106058448 13:26261921-26261943 TGACTAGTCTATTTTATTCCAGG + Intronic
1106147940 13:27068030-27068052 GGACTTGTCTTTTGTATTCCCGG + Exonic
1106911909 13:34471971-34471993 CGGCTAATCTTTTGTATTCTTGG - Intergenic
1108402233 13:50058024-50058046 AGGCTGGTCTCTCAAATTCCTGG - Intergenic
1109672785 13:65632006-65632028 AGGCAAGTCCCTTGCTTTCCTGG + Intergenic
1114242098 14:20877515-20877537 AGGCAAGTTTATTGTATTCATGG - Intergenic
1114248968 14:20941132-20941154 AGGCAAGTTTATTGTATTCATGG - Intergenic
1114498717 14:23152622-23152644 AGGCTGGTCTCTAGAACTCCTGG + Intronic
1116408089 14:44590376-44590398 ATGCTATACTCTTGTATGCCTGG + Intergenic
1117452771 14:55866715-55866737 AGGATGATCTCTTCTATTCCTGG + Intergenic
1118154007 14:63220790-63220812 AGTGCAGTCTTTTGTATTCCAGG - Intronic
1118585837 14:67352256-67352278 AGGCTAGTCTTTTTGACTCCCGG - Intronic
1121550928 14:94799713-94799735 AGGCTAGGCTACTGTTTTCCAGG - Intergenic
1126014611 15:44338269-44338291 AGGTCATTCTCTTCTATTCCAGG - Exonic
1128263135 15:66246591-66246613 AGGCTAGTGTCCTGAACTCCTGG - Intronic
1128561392 15:68670387-68670409 AGGCTGATCTCTTGAAATCCTGG + Intronic
1128684549 15:69674161-69674183 AGGCTTTTCTCCTGTACTCCAGG + Intergenic
1131040635 15:89262941-89262963 AGGCTGGTCTCTTGAACTCCTGG + Intronic
1131948160 15:97651020-97651042 AGGCTGGTCTCTCTAATTCCTGG - Intergenic
1132818091 16:1844671-1844693 AGGCTGGTCTCATGAACTCCTGG + Intronic
1135701202 16:24633989-24634011 AGGCTGGTCTCTTGAACTCCTGG + Intergenic
1138162215 16:54764847-54764869 AGGCTAGGCCCTTGGATACCTGG + Intergenic
1141924255 16:87156956-87156978 AGGCTGGTCTCTTGAACTCCTGG - Intronic
1142191053 16:88717918-88717940 TGGCTAGTCTTTTGTATTTTTGG - Intronic
1151386670 17:73759290-73759312 AGGCAAGTCACATGTCTTCCAGG - Intergenic
1151457948 17:74237840-74237862 AGGCTAGTCTCTCGAGCTCCTGG + Intronic
1152162229 17:78675960-78675982 AAGCTAGTCTCTAGGAATCCAGG + Exonic
1152990072 18:355176-355198 AAGGTAGTCTCTTGTCTTCATGG + Intronic
1156612875 18:38748358-38748380 AGGCTGGTCTCTTGAACTGCTGG + Intergenic
1159115355 18:64107206-64107228 AGGTTAGTCACTTCTAATCCAGG - Intergenic
1161515666 19:4694936-4694958 AGGCTGGTCTCTGAAATTCCTGG - Intronic
925074109 2:997740-997762 AGGCTGGTCTCTGGAATGCCCGG - Intronic
930945058 2:57063182-57063204 GGGCCTGTCTTTTGTATTCCTGG + Intergenic
936923703 2:117715237-117715259 AGGCTAATTTCTTTTCTTCCAGG + Intergenic
936943783 2:117912744-117912766 AGGCTGGTCTCTTGAACCCCTGG + Intergenic
937109077 2:119348783-119348805 AGGCTGGTCTGTTGAACTCCTGG - Intronic
940221770 2:151360084-151360106 AGGCTGGTCTTTTTAATTCCTGG - Intronic
943930509 2:193845392-193845414 AGGCTTTGCTCTAGTATTCCAGG - Intergenic
945784436 2:214215340-214215362 AGGCCAGTCTATTCTATTCTTGG - Intronic
946110893 2:217415390-217415412 AGGCAGTTCTCTTCTATTCCTGG - Intronic
948330922 2:237164309-237164331 AGGAAATTTTCTTGTATTCCTGG + Intergenic
948829738 2:240592597-240592619 AGGCGGGTCTCTTGAACTCCTGG - Intronic
1170911612 20:20576478-20576500 AGGCTTTTCTTTTGCATTCCTGG + Intronic
1178173617 21:30071930-30071952 AGGCACGTCTCTTCTTTTCCTGG - Intergenic
1180612787 22:17108680-17108702 AGGCTGGCCTCTTGAAGTCCGGG - Exonic
1183235307 22:36612447-36612469 AGGCTAGAGTCTTTTACTCCAGG - Intronic
953058283 3:39405624-39405646 AGGCTGGTCTCTTGAACTCCTGG + Intergenic
954530401 3:51313877-51313899 TAGCCAGTCTCTTGCATTCCTGG - Intronic
955307541 3:57849096-57849118 AGGCTGGTCTCTCGAACTCCTGG + Intronic
956239140 3:67109433-67109455 AGGCAAGTGTCTTGCTTTCCTGG - Intergenic
959444310 3:106419190-106419212 TGTCTTGTCTCTTGTGTTCCAGG - Intergenic
962637308 3:137344403-137344425 ACTCTAGTCTCTTGTCTTCTTGG - Intergenic
964174196 3:153805722-153805744 AGGCAAGTCTAGTGTATGCCTGG + Intergenic
966144903 3:176799925-176799947 AGGCTGGTCTGTTTTCTTCCTGG - Intergenic
968682540 4:1931091-1931113 AAGGTCGTCTCTTGGATTCCAGG + Intronic
969010856 4:4060939-4060961 AGGCTGATCTCTAGTTTTCCAGG - Intergenic
971736818 4:30464209-30464231 AAGATTGTCTCTTGGATTCCTGG - Intergenic
975928206 4:79485582-79485604 AGGCAAGTTGCTTTTATTCCAGG - Intergenic
976746427 4:88407618-88407640 AGGCTAGTCTCTTGAACTCCTGG + Intronic
978424121 4:108564277-108564299 AGAGTAGTCTGATGTATTCCTGG - Intergenic
978760917 4:112355946-112355968 AGGCTCCTCTCTTGTCTCCCCGG - Intronic
978874108 4:113617709-113617731 AGGCTGGCCTCTTGAATGCCTGG + Intronic
982264695 4:153527484-153527506 AGGCTGGTCTTTTGAACTCCTGG + Intronic
982970869 4:161984595-161984617 AGGCTAGTCTCTCTAACTCCTGG + Intronic
983329378 4:166304854-166304876 TGGATAATCTTTTGTATTCCTGG - Intergenic
984294386 4:177835855-177835877 AGGCTTGTTTCTAGTATTCTTGG + Intronic
987721415 5:21637929-21637951 AGGCAAATCTGTTGCATTCCAGG + Intergenic
989982925 5:50665689-50665711 AGGCCACCCTCCTGTATTCCAGG + Intergenic
991238319 5:64425503-64425525 AGGATAGTTTTTTGTATTTCTGG - Intergenic
991896641 5:71408380-71408402 TTGCTAGTGTCTTATATTCCTGG - Intergenic
992165391 5:74045237-74045259 CGGCTGGTCTCTTGAACTCCTGG + Intergenic
995069912 5:107908404-107908426 AACCTATTCTTTTGTATTCCAGG - Intronic
995921422 5:117318677-117318699 AGGGAAGTCACTTGAATTCCAGG - Intergenic
998086993 5:139334610-139334632 AGGCTAGTCTCTCAAACTCCTGG + Intergenic
1000061294 5:157658605-157658627 ATGAGAGTCTCTTGTATTCAGGG - Intronic
1000503558 5:162084619-162084641 AGGCTAGTCACTCTTATCCCTGG - Intronic
1001800187 5:174536660-174536682 GGGGTAGTTTCATGTATTCCTGG - Intergenic
1003371804 6:5535692-5535714 AGGGCATTCCCTTGTATTCCTGG + Intronic
1004498802 6:16190295-16190317 AGACAAATCTCTTGTATTCAGGG + Intergenic
1006002643 6:30977578-30977600 AGGCTGGTCTCTGGAATGCCTGG + Intergenic
1006553070 6:34841042-34841064 AGGCTGGTCTCTTTAACTCCTGG + Intronic
1006990035 6:38207410-38207432 AGGCTGATCTCTTGAACTCCTGG - Intronic
1011605690 6:89102974-89102996 AGGCTGGTCTCTCAAATTCCTGG + Intronic
1017974285 6:159341630-159341652 AGGCTGGTCTCCTGAACTCCTGG - Intergenic
1021288631 7:18815756-18815778 ATGCTGGGCTCTTGTTTTCCTGG + Intronic
1022152500 7:27622546-27622568 AGGCTTCTCTCTTCTTTTCCTGG - Intronic
1022729477 7:33008947-33008969 AGGGTAGTCTCTTGAACTCTTGG + Intergenic
1023741142 7:43281768-43281790 AGGCTAGTCTCTTGTATTCCTGG + Intronic
1026740840 7:72977314-72977336 AGGCAAGTCTCTTGTGGTCAGGG + Intergenic
1026798141 7:73378808-73378830 AGGCAAGTCTCTTGTGGTCAGGG + Intergenic
1026826147 7:73583003-73583025 AGGCTGGTCTCTAGAACTCCTGG + Intergenic
1027102893 7:75387760-75387782 AGGCAAGTCTCTTGTGGTCAGGG - Intergenic
1027437373 7:78178291-78178313 CGGCTAGTCACTATTATTCCAGG - Intronic
1032784634 7:135191183-135191205 AGAATAGCTTCTTGTATTCCAGG - Intronic
1035934173 8:3818536-3818558 TGGCTAGTCTCCTGTCTTCTTGG - Intronic
1036390555 8:8320869-8320891 AGGCCAAGCTCTTGTATGCCAGG - Intronic
1041512704 8:58669417-58669439 AGGCTGGTCTCTTGGATTCCTGG + Intergenic
1042771331 8:72385865-72385887 AGGCTTGTCTCTTGAATTCCTGG - Intergenic
1046522774 8:115346485-115346507 TGGCTATTCTCTTTTATTTCTGG - Intergenic
1049512674 8:143037558-143037580 AAGCTGGTCTCTTGAACTCCTGG - Intergenic
1049794650 8:144491402-144491424 AGGCTGGTGTCTGGAATTCCTGG - Intronic
1050642737 9:7685672-7685694 AGGCTTGTCCCTTGAATTCCAGG - Intergenic
1051149389 9:14063943-14063965 AGGCTAGTCTTGAGTATTGCAGG - Intergenic
1052840898 9:33290098-33290120 AGGCTAGTCTCTCCAACTCCTGG - Intergenic
1056744056 9:89284815-89284837 AGGGTCATCTCTTCTATTCCAGG - Intergenic
1056950792 9:91039396-91039418 AGGCTACTCGCTTGTGTTGCAGG + Intergenic
1057053841 9:91946687-91946709 TGGCTAGTCTGTTGTAGTGCTGG - Intronic
1058312315 9:103519159-103519181 AGGCTGGTGTCTTGAACTCCTGG - Intergenic
1060645623 9:125276973-125276995 AGGCTGGTCTTTTGAATTCCTGG + Intronic
1185721307 X:2384029-2384051 TGGCTAGTCTCTCGGCTTCCAGG - Intronic
1186437460 X:9555286-9555308 AGGCTGGTCTTTTGAATTCCTGG + Intronic
1186862205 X:13683884-13683906 AGGGAAGTCCCTTCTATTCCTGG + Intergenic
1187415305 X:19087912-19087934 AGGCTTGCCACGTGTATTCCGGG + Intronic
1187521002 X:20013997-20014019 AGGCTGGTCTCCTGGATCCCAGG + Intronic
1188220011 X:27530037-27530059 CTGTTAGTCTCTTTTATTCCAGG - Intergenic
1189408450 X:40747419-40747441 AGGCTGGTCTCTCAAATTCCTGG + Intergenic
1193545080 X:82816893-82816915 AGTGTAGTCTCTAGTTTTCCAGG + Intergenic
1193579081 X:83240537-83240559 AGGCTAGTTTTTGCTATTCCTGG - Intergenic
1194718035 X:97309308-97309330 AGGCTGGTCTCTCGAACTCCTGG + Intronic
1195421790 X:104683803-104683825 AAGCCAGACTCTTCTATTCCTGG - Intronic
1195927045 X:110036760-110036782 AGGCTATTCTCTTGTGTATCTGG + Intronic
1196774748 X:119328078-119328100 AGGGTAGGCTCTGGCATTCCAGG - Intergenic
1198878582 X:141254251-141254273 ATTCTACTCTCTTGCATTCCCGG + Intergenic
1200509164 Y:4054862-4054884 AGTCTACTCTCTTTTATTCTTGG - Intergenic