ID: 1023742219

View in Genome Browser
Species Human (GRCh38)
Location 7:43290823-43290845
Sequence GTCTCCACCATGACAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023742219_1023742220 -10 Left 1023742219 7:43290823-43290845 CCAGCTGTTGTCATGGTGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 121
Right 1023742220 7:43290836-43290858 TGGTGGAGACCTAAGAGCCATGG 0: 1
1: 0
2: 0
3: 17
4: 174
1023742219_1023742224 7 Left 1023742219 7:43290823-43290845 CCAGCTGTTGTCATGGTGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 121
Right 1023742224 7:43290853-43290875 CCATGGTGGAACGAAGTTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 65
1023742219_1023742221 -7 Left 1023742219 7:43290823-43290845 CCAGCTGTTGTCATGGTGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 121
Right 1023742221 7:43290839-43290861 TGGAGACCTAAGAGCCATGGTGG 0: 1
1: 0
2: 2
3: 28
4: 357
1023742219_1023742227 26 Left 1023742219 7:43290823-43290845 CCAGCTGTTGTCATGGTGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 121
Right 1023742227 7:43290872-43290894 CAGGAGCAGTTTTCAGTCCAGGG No data
1023742219_1023742226 25 Left 1023742219 7:43290823-43290845 CCAGCTGTTGTCATGGTGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 121
Right 1023742226 7:43290871-43290893 CCAGGAGCAGTTTTCAGTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023742219 Original CRISPR GTCTCCACCATGACAACAGC TGG (reversed) Intronic
903852832 1:26318473-26318495 GTCACCTCCATAACCACAGCAGG - Intronic
904999359 1:34656300-34656322 GTCTCCAGCATGACAAGCCCTGG - Intergenic
905112729 1:35608790-35608812 GTCCCCAGCATGACAACTGAAGG - Intronic
905865729 1:41375593-41375615 GTCCCCACCATGGCTACAGAGGG - Intronic
906150592 1:43585261-43585283 GCCACCCCCATGCCAACAGCTGG - Intronic
907336323 1:53702161-53702183 CTCCCCACCATCACAGCAGCAGG + Intronic
907413395 1:54297956-54297978 GTCTCTACCCTGACCCCAGCAGG + Intronic
909138557 1:71833618-71833640 GTCTCCAGCAATACAAAAGCTGG + Intronic
911097818 1:94069570-94069592 GTGTCTACCTTGACACCAGCAGG - Intronic
912253904 1:108039686-108039708 GGCTCCACAATGAGAACACCTGG - Intergenic
915724091 1:158005492-158005514 GTTTCCACCAGCACACCAGCAGG - Intronic
917512734 1:175681670-175681692 GTCTCCACCTGTACAACAGTGGG + Intronic
920047278 1:203141411-203141433 GACTCCAGCATGGCAAGAGCTGG + Intronic
922829815 1:228546471-228546493 GTCTCTATCATTAGAACAGCTGG + Intergenic
1063045967 10:2392786-2392808 GCCTCCAGCAGGACAACAGTGGG - Intergenic
1068264144 10:54625491-54625513 TTCACCATCATGAGAACAGCAGG - Intronic
1071251534 10:83824396-83824418 AACTCCACCATAAAAACAGCTGG + Intergenic
1072243498 10:93520026-93520048 GCCTCCAGCATCACAGCAGCTGG - Intronic
1072246236 10:93546780-93546802 GCCTCCACCATCACTGCAGCAGG + Intergenic
1073594925 10:104790032-104790054 GTCTTCCCCAGGACAAAAGCAGG + Intronic
1076904493 10:133355357-133355379 GTCTTCACCAGGCCTACAGCAGG + Exonic
1077466393 11:2735633-2735655 GTCACCACCAAGACCACAGTGGG + Intronic
1081761369 11:45578403-45578425 GGCTCCACCATGAGAAGAGCAGG - Intergenic
1083340195 11:61954382-61954404 GTCTCCACCATCACAGCATCAGG + Intronic
1087396869 11:97610603-97610625 GCCTCCACCGTGACAGCTGCAGG - Intergenic
1089364394 11:117912100-117912122 GTCTCCACCATGAGAAATGCTGG - Intronic
1096698973 12:53369765-53369787 GTCTCTAGCATGGCAACAGAGGG + Intergenic
1097671235 12:62541264-62541286 GTCTCAGCCATGAGAACAGCTGG - Intronic
1101559082 12:105838729-105838751 GTTTCCACCATGAACACAGATGG - Intergenic
1101576433 12:106001280-106001302 GTGTCCACCAGGATAACAGGAGG - Intergenic
1103351618 12:120287579-120287601 CTCTCCACCTGGAAAACAGCTGG + Intergenic
1103685012 12:122725198-122725220 GTCTCCACCTTGAGAACAACTGG + Intergenic
1106227711 13:27797351-27797373 GTCACCACCTTGGCAACAACTGG - Intergenic
1109152326 13:58860175-58860197 GCCTCCACCTTGACAGCCGCAGG - Intergenic
1110470041 13:75849208-75849230 CCCTTCACAATGACAACAGCTGG + Exonic
1112091340 13:96087515-96087537 TACTCCACGATGACACCAGCTGG - Intergenic
1115283585 14:31692451-31692473 GTTTACACTATGACCACAGCAGG - Intronic
1115388160 14:32821856-32821878 GTCTCCTCCATGACATGCGCAGG - Exonic
1115801220 14:36996099-36996121 GTTTTCACCATGACCATAGCTGG + Intronic
1116523037 14:45872444-45872466 TTCACTACCATGAAAACAGCAGG + Intergenic
1120002516 14:79318579-79318601 GACTGAAACATGACAACAGCTGG - Intronic
1120779564 14:88474687-88474709 ATCTCCATCATGACACCAGGAGG + Intronic
1124658890 15:31529092-31529114 GTCCCCATCAGCACAACAGCGGG - Intronic
1125613299 15:40987568-40987590 GTCTCCACATGAACAACAGCTGG + Intronic
1125716602 15:41823121-41823143 GTCTCAACCCTGACAGCAGCTGG + Exonic
1131407113 15:92174268-92174290 GGCTCAACCAAAACAACAGCAGG + Intergenic
1132770489 16:1559652-1559674 GTCCCAGCCATGACCACAGCTGG + Intronic
1133316295 16:4886041-4886063 GTCTTCTCCATCACAGCAGCCGG - Exonic
1134380674 16:13721917-13721939 TTCACTACCATGAGAACAGCAGG - Intergenic
1138993459 16:62419950-62419972 TTCTCCAGAATGATAACAGCAGG - Intergenic
1141002522 16:80321820-80321842 GTCTCCACCATCAAAGCAGAAGG + Intergenic
1141270809 16:82539752-82539774 CTCTCCATCAAGACAACAGTGGG - Intergenic
1142083120 16:88160678-88160700 GCCTCAACCCTAACAACAGCGGG - Intergenic
1142590308 17:1001972-1001994 GTCACCAAGATGACCACAGCAGG - Exonic
1143319642 17:6059789-6059811 CTGTTCGCCATGACAACAGCAGG + Intronic
1143973438 17:10812695-10812717 ATCACCACCATGAGAGCAGCTGG + Intergenic
1146615332 17:34352253-34352275 GACTCCAACAGGATAACAGCTGG + Intergenic
1157527444 18:48395098-48395120 TTCTCCAGCATGACAACAAAGGG + Intronic
1158208421 18:55020146-55020168 CTATCCACCATGACCACTGCTGG + Intergenic
1159516183 18:69461390-69461412 CACTCCACCATGGGAACAGCTGG + Intronic
1160018227 18:75160130-75160152 GTGTCCACCTTGCAAACAGCAGG - Intergenic
1161845508 19:6709839-6709861 GTCTCCACCCTCCCCACAGCTGG - Exonic
1161922353 19:7276008-7276030 CTCTCCATCATGAAAACAGCAGG + Intronic
927129947 2:20050792-20050814 GGCTGCACCAGGACAAAAGCTGG + Intronic
927387605 2:22553391-22553413 GCCTCCTCCATGATATCAGCAGG + Intergenic
927902191 2:26828541-26828563 GTTTCCACCATGACAAGAGAAGG - Intergenic
929811426 2:45192209-45192231 GTCTCCAGCATGACATCAGCCGG - Intergenic
931281218 2:60793640-60793662 TTCTCCACAATTACAGCAGCAGG - Exonic
933141325 2:78794978-78795000 GCCTCCACCCTGACAGCTGCAGG - Intergenic
933969111 2:87455880-87455902 GTCTCTTCCAAGACAACAGAAGG - Intergenic
934560226 2:95309364-95309386 GCCTCCACCATGACCCCAGGAGG + Intronic
936324679 2:111494628-111494650 GTCTCTTCCAAGACAACAGAAGG + Intergenic
940126296 2:150329240-150329262 TTTTCCAGCATGACAACTGCAGG + Intergenic
944399589 2:199310068-199310090 GGCTGCACAATGAGAACAGCTGG - Intronic
946185917 2:217980240-217980262 ATCTCCACCCTGGCCACAGCAGG + Intronic
948081909 2:235213751-235213773 GTCCCCTCCATGACATCAGGGGG - Intergenic
1168940759 20:1709180-1709202 GTCTCCACCATAACATCTGCAGG - Intergenic
1170697718 20:18674816-18674838 GTCTCCACCAGCACAACTGCAGG - Intronic
1174876422 20:54231191-54231213 CATTCCACCATGGCAACAGCTGG - Intergenic
1175274767 20:57760806-57760828 GTTTCCACCATCACAGCAGTGGG + Intergenic
1179166799 21:38941578-38941600 TTCACCACCATGAGAACAGTAGG - Intergenic
1180748111 22:18105857-18105879 GTCTCCAGCATAACCACTGCAGG - Intronic
1182528309 22:30935450-30935472 GTCTCCCCAATGAGAACAGGAGG - Intronic
1184542437 22:45135823-45135845 GTCTACATCATGACAACACATGG - Intergenic
950359877 3:12442627-12442649 GTCTCCACCGTGCAAAAAGCAGG - Intergenic
952066775 3:29579652-29579674 GTCTCTACCATCAAAACAGCAGG - Intronic
952109703 3:30108695-30108717 ATCTCCACCAAGGCAAGAGCTGG - Intergenic
953468440 3:43146077-43146099 GACTCCATCATGGCACCAGCTGG + Intergenic
960434342 3:117607382-117607404 TTTTCCACCTTGACTACAGCAGG - Intergenic
962304108 3:134270643-134270665 GTATCCACCATGACCAGAGTTGG + Intergenic
965181117 3:165404794-165404816 GTCTCCACCTTCAGGACAGCTGG - Intergenic
969065997 4:4481738-4481760 GTCCCCACTGTGACATCAGCAGG - Intronic
970439508 4:16068009-16068031 TTCTCCACCATGAGGACTGCAGG + Intronic
972056069 4:34805323-34805345 TTCACCATCATGAGAACAGCAGG + Intergenic
974430458 4:61790917-61790939 GTCACTACCATGAAAATAGCAGG + Intronic
975182314 4:71361038-71361060 TTCTCCACCCTGAGAACAGAGGG + Intronic
978850022 4:113323773-113323795 GTCTTGAACGTGACAACAGCAGG + Intronic
980716583 4:136637155-136637177 GCCTCCACCTTGACAGCAGCAGG + Intergenic
982579229 4:157157072-157157094 GTCTCTACCAACACAGCAGCAGG + Intronic
994726147 5:103437916-103437938 GTCTTCAACATGTCAACAACAGG + Intergenic
994867873 5:105300984-105301006 GTCACTATCATGAGAACAGCAGG + Intergenic
995217704 5:109614177-109614199 GTCTTCACCATCACAACAAGAGG + Intergenic
998523051 5:142817766-142817788 CTCTCCACCATCACTGCAGCAGG - Intronic
1001130125 5:169056987-169057009 GTCTCCATAATGACAAGAGCAGG + Intronic
1002423034 5:179159656-179159678 CTCTGCACCATGACATCAGCAGG + Intronic
1006738085 6:36289339-36289361 GTCTCGCCCATAACACCAGCTGG - Intronic
1008155456 6:48008699-48008721 ATCTCCATCATCACAGCAGCAGG - Exonic
1010678962 6:78777001-78777023 CTCTCTCCCATGACAGCAGCAGG + Intergenic
1011432169 6:87299227-87299249 GTCTGAACCATGACAACCCCTGG + Intronic
1013017710 6:106176152-106176174 CTCTCCACCATGTTAACAGCTGG + Intergenic
1013248378 6:108310162-108310184 GTCTCCCCCAGGTCAAAAGCCGG - Intronic
1015439148 6:133227533-133227555 GTCTCCATCAAGAACACAGCTGG - Intergenic
1015679609 6:135790861-135790883 GTCTCCAGCATGATAACAGTAGG + Intergenic
1017598250 6:156053386-156053408 GCCTCCAACATGACAACAATTGG - Intergenic
1019153554 6:170024194-170024216 GTCTCCACCGTGACGTCACCGGG - Intergenic
1020453227 7:8343829-8343851 GTCTCCTCAATGACAGCTGCTGG - Intergenic
1023742219 7:43290823-43290845 GTCTCCACCATGACAACAGCTGG - Intronic
1026159177 7:67853597-67853619 GACTCCACGCTGACATCAGCTGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029239513 7:99149360-99149382 GCCTCCACCATATCACCAGCCGG + Intergenic
1030974396 7:116103226-116103248 GTCTCCACAAAGACAAAAGCAGG + Intronic
1032017015 7:128386756-128386778 GTCTCCAGCTTGGCAACTGCAGG + Intergenic
1035584296 8:759962-759984 GTCTCAACCCTGACAATTGCTGG - Intergenic
1036174030 8:6519182-6519204 GTCCACACCATGAGAACCGCTGG - Intronic
1036546850 8:9779508-9779530 GTATCCAGCAGGCCAACAGCAGG - Exonic
1041605849 8:59781567-59781589 GTCTCTACAAAGACAAAAGCAGG + Intergenic
1046783879 8:118245117-118245139 GTCTTCATCATGACCACCGCTGG + Intronic
1048822133 8:138390303-138390325 TTCACTACCATGAAAACAGCTGG - Intronic
1052412280 9:28137085-28137107 GTCTCCAGCTTGCCAACTGCAGG + Intronic
1054746725 9:68861450-68861472 GTCTCCACCCTGGCAACAGAAGG - Intronic
1055167097 9:73210256-73210278 GTCTTCTCCATGACAACACCAGG + Intergenic
1061741275 9:132708248-132708270 GTCTCCACCCTGAAAGTAGCTGG + Intergenic
1062334645 9:136059695-136059717 CTCTCCACCATGACAAGGACGGG + Intronic
1185721674 X:2387585-2387607 GTGGCCACCATGTCATCAGCAGG - Intronic
1193256364 X:79353851-79353873 CTCTCTATCATGAGAACAGCAGG - Intergenic
1195989888 X:110672045-110672067 ATCTCTTCCATGACCACAGCAGG + Intergenic
1196770813 X:119291439-119291461 CTCACTACCATGAGAACAGCAGG - Intergenic
1199457760 X:148048325-148048347 TTCACTACCATGAGAACAGCAGG - Intergenic
1199608193 X:149593197-149593219 GTCTGCACCAAGACATCAGGAGG - Exonic
1199630927 X:149776163-149776185 GTCTGCACCAAGACATCAGGAGG + Exonic
1200125428 X:153811647-153811669 TTCTCCACCTTGACAACCACTGG - Intronic
1201391084 Y:13498175-13498197 GTCTGCACTAAGGCAACAGCGGG - Intergenic