ID: 1023743817

View in Genome Browser
Species Human (GRCh38)
Location 7:43303736-43303758
Sequence GGTTTCAGGAACAGGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023743817 Original CRISPR GGTTTCAGGAACAGGTGTCT GGG Intronic
900105245 1:978310-978332 GGTTTCGGGAAGACGTGTCCAGG - Intronic
906102048 1:43270170-43270192 GGATTCAGGAACAGGAGTCGAGG + Intronic
910165745 1:84325735-84325757 CTTTTCAGGAACAGGTAACTTGG + Exonic
916557523 1:165906125-165906147 GGCCTCAGGAACAGGTCCCTGGG + Intronic
921161321 1:212473934-212473956 GTTTTCATGAACAGGTGACTGGG + Intergenic
922418855 1:225446182-225446204 GGTGTCAGGTACAGGGATCTGGG - Intergenic
923843533 1:237701586-237701608 GGTTTCAAGTACAGTTGTCTGGG + Intronic
1063124284 10:3125726-3125748 GGTTTCACCAACATGTGCCTTGG + Intronic
1063250738 10:4271237-4271259 TTTTTTAGGAACATGTGTCTAGG + Intergenic
1064145415 10:12822859-12822881 TGTTTCAGGAATATGTGTCTGGG + Intronic
1066162242 10:32746397-32746419 GGTGGCAGGGACAGGGGTCTAGG + Intronic
1066985656 10:42464486-42464508 AGTTACAGGCACAGGTGCCTGGG + Intergenic
1067873127 10:49979803-49979825 AGTTACAGGCACAGATGTCTGGG - Intergenic
1069633509 10:69911883-69911905 GGTTTCAGGAATAGCTGTCGTGG - Intronic
1070106048 10:73432335-73432357 GGTTTAAGAAAGTGGTGTCTTGG - Intronic
1071510716 10:86260978-86261000 GGTTTGAGGAACGTGTGTTTAGG - Intronic
1071781399 10:88849851-88849873 GATTTCAGGACCAGCTCTCTGGG + Intronic
1073076155 10:100826891-100826913 GGTCTCAGGCGCAGGTGTCGCGG - Intronic
1074362544 10:112834777-112834799 GGTTTCAGGAGCTGGTCTCCTGG - Intergenic
1076342265 10:129757568-129757590 GATTTCGGGGACAGCTGTCTTGG - Intronic
1076746367 10:132516878-132516900 GGTTTCTGGAGCAGGTGACTTGG - Intergenic
1080692873 11:34573633-34573655 GGTTTCAGGGATGGGTGTGTTGG + Intergenic
1080947734 11:36993859-36993881 GGTTTCAGACACAGCAGTCTGGG - Intergenic
1082264945 11:50108261-50108283 GGTTTCTGGCTCAGGTATCTTGG - Intergenic
1085405916 11:76262127-76262149 TGTTCCAGGAACTGGTTTCTGGG - Intergenic
1086575225 11:88331886-88331908 GGTTTCTGTAACAAGGGTCTTGG + Intronic
1086809032 11:91282025-91282047 GGTTTGAGGAATAGGTGTCAAGG - Intergenic
1089412956 11:118262583-118262605 GGTTTAAGGACCGGGTGTCTTGG - Exonic
1089703280 11:120258740-120258762 GGTTTCAGAAAAAAGTGTCCAGG - Intronic
1090628086 11:128623294-128623316 GGTTTCTAGAAAAGATGTCTGGG - Intergenic
1090722360 11:129488193-129488215 GCTCTTAGGAACAGGGGTCTGGG - Intergenic
1091196774 11:133738386-133738408 AGGTTCAGGAAAAGGTGTCAAGG + Intergenic
1093121619 12:15277760-15277782 GGTTACATGAACAGGAGTATGGG - Intronic
1095857199 12:46873394-46873416 TGTTTCAGGGTCAGGTGCCTTGG + Intergenic
1096201637 12:49687829-49687851 GGGTTCAGCAACAGGTTTATAGG - Intronic
1096628220 12:52907994-52908016 GGTTTGAGGCAGAGTTGTCTGGG - Intronic
1101663977 12:106793002-106793024 AGTTTCAGCAACAGGTAGCTGGG - Intronic
1102440899 12:112963308-112963330 GGGTCCAGGACCAGGGGTCTGGG - Exonic
1102868162 12:116390874-116390896 GGGTGCAGGGACAGGAGTCTGGG + Intergenic
1103448083 12:121007868-121007890 GGGGTCAAGAACAGGTGCCTGGG - Intronic
1104731345 12:131107172-131107194 GGATTCAGACACAGGTCTCTGGG - Intronic
1104731358 12:131107224-131107246 GGATTCAGACACAGGTCTCTGGG - Intronic
1104731370 12:131107276-131107298 GGATTCAGACACAGGTCTCTGGG - Intronic
1106653389 13:31716465-31716487 GGTGACAAAAACAGGTGTCTTGG - Intergenic
1106979404 13:35259171-35259193 GGTTTCAAGAACAGGTATTCAGG - Intronic
1107462596 13:40618361-40618383 GTTTTCAGGGCCAGGTGTCATGG - Intronic
1108086024 13:46794716-46794738 GGTTTTGGGAACACCTGTCTAGG - Intronic
1111592762 13:90371179-90371201 GGTAGCAGGGACAGGTGTCATGG + Intergenic
1113328022 13:109301733-109301755 GGTTCCAGCAGCAGCTGTCTTGG + Intergenic
1113837424 13:113337685-113337707 GGGGTCAGGAACAGCTGTTTTGG - Intronic
1113863696 13:113507870-113507892 GATTTCAGGAGAATGTGTCTTGG + Intronic
1114282520 14:21206424-21206446 GGTTTCAAGAAACGGTGGCTGGG - Intergenic
1116492486 14:45521995-45522017 AGTTTCAGAAACAGTTATCTAGG + Intergenic
1122119792 14:99546141-99546163 GGTTTCAGGAGAAAGTGTGTGGG + Intronic
1122384773 14:101336865-101336887 TGTATCAGGAACAGATGTCAGGG + Intergenic
1122763580 14:104048927-104048949 GGGTTCAGGGGCAGGTGTATGGG + Intronic
1124057619 15:26256649-26256671 GGTGTAAGGAACCAGTGTCTGGG + Intergenic
1125628224 15:41126595-41126617 GGTGTCAGCAACAGGTAGCTGGG + Intergenic
1125949693 15:43741556-43741578 GGCTTCAGGGACTGGTTTCTTGG - Intergenic
1126526185 15:49657027-49657049 GTTTTCAGGGAAATGTGTCTTGG - Intergenic
1129919146 15:79304740-79304762 GGTTTCAGGAACAGAGGACAAGG + Intergenic
1130066802 15:80611663-80611685 GGTTTTAGAAACAGGCTTCTTGG + Intergenic
1130997081 15:88909906-88909928 GGTTTTTGGAACAGATATCTGGG + Exonic
1132147680 15:99438111-99438133 TGATTCAGGAAAAAGTGTCTAGG - Intergenic
1132301394 15:100778382-100778404 GCATTCACGAACAGGTTTCTGGG + Intergenic
1133020876 16:2966530-2966552 AGGTTCAGAAACCGGTGTCTGGG - Intronic
1133767274 16:8846802-8846824 GGTCTCTGGAACAGGTGGCCTGG - Intronic
1135644284 16:24147712-24147734 GATTTAAGGGACAGGTGACTAGG + Intronic
1135894384 16:26385628-26385650 GGTTTCAGGATTAGGTCTCTAGG - Intergenic
1142112618 16:88340392-88340414 GGTGACATGAACAGGTGTCATGG + Intergenic
1144796218 17:17892999-17893021 GAATTCAGGAGCAGGTGGCTGGG - Intronic
1144962287 17:19051661-19051683 AGTCTCAGCAACAGGTGGCTGGG - Intergenic
1144972874 17:19122859-19122881 AGTCTCAGCAACAGGTGGCTGGG + Intergenic
1148750739 17:49944495-49944517 GTTTGCAGGAGCAGGGGTCTAGG - Intergenic
1149517661 17:57292618-57292640 GGTTTCAGTCACAGATGTCCAGG - Intronic
1149608433 17:57941312-57941334 TCTGTCAGGAACTGGTGTCTGGG + Intronic
1150464217 17:65378108-65378130 GTTTTGGGAAACAGGTGTCTAGG - Intergenic
1151254488 17:72865191-72865213 GGTCCCAGGAACAGGGGCCTGGG + Intronic
1151947123 17:77325839-77325861 GGTTTGAGGCACAGGGGTTTGGG - Intronic
1152183394 17:78839771-78839793 GATTACAGGAACACTTGTCTCGG - Intronic
1155566056 18:27135733-27135755 GTTTTAAGGAACACGTGCCTTGG - Intronic
1155620978 18:27779364-27779386 CTTTTCAGGAACAGGTGAATAGG - Intergenic
1155695986 18:28687113-28687135 GGCTTCAGGGACAGGCTTCTTGG - Intergenic
1156504423 18:37580123-37580145 GGTTTCAAGAATGGGTGTTTTGG - Intergenic
1157737439 18:50062693-50062715 GGGTTCAGGATGCGGTGTCTGGG - Intronic
1157781106 18:50440009-50440031 GGTTCCAGGAAAAGGACTCTGGG - Intergenic
1160574578 18:79845255-79845277 GGGTTCAGGAGGAGGTGGCTGGG + Intergenic
1162519675 19:11172471-11172493 GGGCTTATGAACAGGTGTCTGGG - Intronic
1166452722 19:42915713-42915735 GGATTTAGGGACAGGGGTCTGGG + Intronic
1166455205 19:42934994-42935016 GGATTTAGGGACAGGGGTCTGGG + Intronic
1166458497 19:42965323-42965345 GCTATCAGGAACATGTGTCCAGG - Intronic
1166475441 19:43120578-43120600 GCTATCAGGAACATGTGTCCGGG - Intronic
1166491882 19:43267372-43267394 GGATTTAGGGACAGGGGTCTGGG + Intronic
926770322 2:16366384-16366406 GGTTGCAGTAACAGCTGGCTAGG - Intergenic
928420212 2:31132437-31132459 GTTCCCAGGAGCAGGTGTCTGGG - Intronic
932388062 2:71356870-71356892 AGTTTCAGGAGCAGCTGTATTGG + Intronic
932687507 2:73885210-73885232 GGTATCAGGGCCAGGTGTCGTGG - Intergenic
934919109 2:98328002-98328024 GGCATCAGAAACAGGTGCCTTGG - Intergenic
936877934 2:117214765-117214787 GGTTTGAGGAACAGTGGCCTAGG - Intergenic
937693910 2:124786649-124786671 GGATTCAGAAACAGATTTCTGGG + Intronic
938436489 2:131286324-131286346 GGCCTGAGGACCAGGTGTCTTGG + Intronic
938601920 2:132851156-132851178 GGTTTTATGAACAGGAGACTTGG + Intronic
938673253 2:133604852-133604874 GGTTTCAGCAACAGGAATGTGGG + Intergenic
939925767 2:148172282-148172304 GGCAGCAGGAGCAGGTGTCTTGG - Intronic
940642816 2:156364943-156364965 GGGTTCAGGTACTGGTTTCTTGG - Intergenic
942642298 2:178072695-178072717 GGTTTCCGGAACAGGAGCCGGGG - Exonic
945021285 2:205574359-205574381 GGTTTCAGGAAGAGATTTCCAGG + Intronic
947623532 2:231605301-231605323 GGCTTCGGGAACAGGTGTCCAGG - Intergenic
948213759 2:236214145-236214167 GGTCCCAGGAACAGCAGTCTAGG + Intronic
948293383 2:236843797-236843819 GATTTCTGCAACAGGTGTCACGG - Intergenic
1169371473 20:5031407-5031429 GATTTCAGGAAGAGGTGCCCGGG - Intergenic
1170737418 20:19023908-19023930 TCTTTCTGGAACAGGTGCCTGGG - Intergenic
1173413491 20:42836312-42836334 GGTTTCAGGGACTTGTCTCTTGG - Intronic
1175557391 20:59876940-59876962 GCTTTCAAAAACAGGTGACTGGG + Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1182067762 22:27442618-27442640 CTTTTCAAGAACAAGTGTCTTGG - Intergenic
1184112843 22:42405367-42405389 GGCTTCAGGCACAGGTGACAAGG - Intronic
1184718547 22:46296020-46296042 GGATGCAGGAAGAGGAGTCTGGG - Intergenic
1185078969 22:48698894-48698916 GGTCTGAGGAACAGGGCTCTGGG - Intronic
949268126 3:2184414-2184436 GGTTCCACCAACAAGTGTCTAGG - Intronic
957598598 3:82301841-82301863 GGTCACAGCAACAGGTGTTTGGG + Intergenic
959896316 3:111610898-111610920 AGTTTCATGAATAAGTGTCTTGG - Intronic
966292983 3:178382343-178382365 GGTTGCAGGAAAAGGAGTTTGGG - Intergenic
966423922 3:179760721-179760743 GGTTTAAGGAACAGGCTTTTAGG + Intronic
966470793 3:180286595-180286617 GGTTTCAGGGACATGTAGCTGGG + Intergenic
966489432 3:180510758-180510780 GTTTTCAGGAATAGAAGTCTAGG - Intergenic
969268223 4:6080092-6080114 GGTGTCAGGAACGGGTGTTGGGG - Intronic
969664506 4:8549421-8549443 GGTTCCAGGAAAGAGTGTCTGGG - Intergenic
969860547 4:10032360-10032382 GGTTTCAGGGACTGGTGTGGTGG + Intronic
971065019 4:23021695-23021717 GGTTTCAGGGCCAGGTGTGGTGG - Intergenic
974500672 4:62697340-62697362 GATTTTAGGAAAAGGTTTCTGGG + Intergenic
975559437 4:75695382-75695404 GGTGACAGGTACAGGTGTCTAGG + Intronic
975725044 4:77283758-77283780 GATTTCAGGGTCAGGGGTCTGGG + Intronic
977196392 4:94066295-94066317 AGTTTCAGCAAAAGGTGTTTTGG - Intergenic
978155064 4:105480375-105480397 GGGTTTAGGAACAGGTGTACGGG - Intergenic
979514373 4:121590222-121590244 AGTGTTAGAAACAGGTGTCTTGG + Intergenic
981440431 4:144776069-144776091 GAATTCAGGACCAGATGTCTTGG - Intergenic
981610283 4:146586754-146586776 GGTTGCAGGAGAAGGTGACTTGG - Intergenic
986268340 5:6209960-6209982 AGTTTCAGGAACATGTGTGCAGG - Intergenic
987006546 5:13716053-13716075 GGGTTAAGGAACAGATGTCATGG + Intronic
991355578 5:65766127-65766149 GGTTTCAGGCAGTGGTGGCTTGG + Intronic
992775281 5:80083528-80083550 GGTCTCAGAAACACGTGTTTGGG + Intergenic
993679826 5:90862621-90862643 GTGTTCTGGAACAGGTGTGTAGG - Intronic
993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG + Intergenic
995260948 5:110103964-110103986 GGTTTCAGGAACAATTGGCTGGG - Intergenic
996546601 5:124685717-124685739 GGTTTCAGGATCAGGTGGGCTGG - Intronic
997418731 5:133749573-133749595 GGTGTCAGCAACATGTGTGTGGG - Intergenic
1001019966 5:168174499-168174521 GGCTTCAGGCACAGATGGCTGGG + Intronic
1003860446 6:10317883-10317905 GGTGTCAGGAACAGGTGTCTGGG - Intergenic
1004844789 6:19627967-19627989 GGATTCAGGATAATGTGTCTAGG - Intergenic
1004887763 6:20068363-20068385 GGTTTCAGAAACCGGTGTTCTGG + Intergenic
1008874632 6:56312415-56312437 GCTTTCAGGCACATGTGACTGGG + Intronic
1010285620 6:74074314-74074336 GGTTTCAGGGAGTGGTGGCTGGG + Intergenic
1011782169 6:90801713-90801735 GGGGTCAGGAAAAGCTGTCTAGG + Intergenic
1013433936 6:110082405-110082427 GGTGTCAGGAAAATGTGTGTGGG - Intergenic
1015515873 6:134082122-134082144 TGTTTCAGGAAAAGCTGTGTTGG - Intergenic
1015635827 6:135272946-135272968 GGTGTCAGGATCAGATTTCTGGG - Intergenic
1015865808 6:137725305-137725327 GGTTTCTGGTTAAGGTGTCTGGG - Intergenic
1017485453 6:154898011-154898033 AGATTCACGAACAGTTGTCTTGG - Intronic
1023743817 7:43303736-43303758 GGTTTCAGGAACAGGTGTCTGGG + Intronic
1027639952 7:80720598-80720620 TATTTCAGGACCAGGTGTCCTGG + Intergenic
1028577774 7:92371263-92371285 GGTTTCACGAATAGGTCTTTTGG + Intronic
1029282001 7:99441381-99441403 GGCCTCAGGAACAGGTATGTGGG - Intronic
1031265488 7:119574241-119574263 AGTTTCAGGGACAGGTGTGCAGG + Intergenic
1031440771 7:121792200-121792222 TGCTTCAGGAACAGATGTATGGG + Intergenic
1032112935 7:129092126-129092148 GGTTCCAGGACCAGTTATCTTGG + Intergenic
1034172633 7:149074387-149074409 GTTTTGAGGAACAGCTGTTTTGG - Exonic
1035034185 7:155884604-155884626 GGGTGCAGGCACAGGTGCCTAGG - Intergenic
1041411940 8:57565685-57565707 GGTCTCAGAAAGAGGTGTCCAGG + Intergenic
1041490314 8:58426010-58426032 GGTTTCAGGGACACCTCTCTGGG - Intronic
1041679043 8:60568109-60568131 GGTTTCAGGAACAGGAATGGGGG + Intronic
1044219232 8:89649907-89649929 GATTTCAGGCACAGGGGCCTTGG - Intergenic
1045545705 8:103126369-103126391 GGTTGAAGGAACACGTGTCTGGG + Intergenic
1046907479 8:119589288-119589310 GGTGACAGGCACAGATGTCTGGG - Intronic
1047454055 8:124992905-124992927 AGTTTATGGAACAGGTGTATGGG - Intergenic
1053240948 9:36495107-36495129 TGTTTCAGTAAATGGTGTCTAGG + Intergenic
1055591278 9:77817124-77817146 GGATTCAGGAACAGGACTCCAGG - Intronic
1056135664 9:83627473-83627495 GTTTAAAGGAACAGGTGACTTGG + Intronic
1056578986 9:87876658-87876680 GGCTTCAGTGACAGGTCTCTGGG + Intergenic
1057401466 9:94726909-94726931 GGTTTCAGCCCCAGGAGTCTGGG - Intronic
1061964811 9:134007182-134007204 GGTCACACGAACAGGTGTCAGGG - Intergenic
1062196543 9:135277228-135277250 GGTTCCAGGCACTTGTGTCTGGG - Intergenic
1062378579 9:136275993-136276015 GGTTTCAGCCACATGTGTCCTGG - Intergenic
1186185028 X:7012387-7012409 GCTATCAGGAACATGTGTCCAGG - Intergenic
1187213325 X:17251034-17251056 AGTAACAGAAACAGGTGTCTAGG - Intergenic
1190249175 X:48709079-48709101 GGTTTGAGGAACATGTTCCTGGG - Intergenic
1191591450 X:62889355-62889377 GGTTGCAGGAACTGCTGACTAGG + Intergenic
1201784469 Y:17758813-17758835 GTTATCAGGAACAGGTGTGCAGG - Intergenic
1201817084 Y:18147174-18147196 GTTATCAGGAACAGGTGTGCAGG + Intergenic