ID: 1023747413

View in Genome Browser
Species Human (GRCh38)
Location 7:43334062-43334084
Sequence ACTTGGCTGAAACACTCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023747413_1023747416 9 Left 1023747413 7:43334062-43334084 CCTATTGAGTGTTTCAGCCAAGT 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1023747416 7:43334094-43334116 TGCATAGCCACAGCTGTTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 146
1023747413_1023747419 28 Left 1023747413 7:43334062-43334084 CCTATTGAGTGTTTCAGCCAAGT 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1023747419 7:43334113-43334135 TTGGTGAGGACAGAGATCTGTGG No data
1023747413_1023747417 14 Left 1023747413 7:43334062-43334084 CCTATTGAGTGTTTCAGCCAAGT 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1023747417 7:43334099-43334121 AGCCACAGCTGTTTTTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023747413 Original CRISPR ACTTGGCTGAAACACTCAAT AGG (reversed) Intronic
901169192 1:7243493-7243515 ACCTGACAGAAACAATCAATGGG - Intronic
901227015 1:7619318-7619340 ACATGGCTGAACCCCTGAATAGG - Intronic
905962167 1:42052352-42052374 ACTTGGCAGACACACTGACTTGG - Intergenic
907591193 1:55673216-55673238 ACCTGGGTGATACACTCCATAGG - Intergenic
908789744 1:67769936-67769958 ACTTAGCTGAAAATCTGAATGGG + Intronic
910634532 1:89392625-89392647 ATTTGACTGAAGCACTGAATAGG + Intergenic
911107218 1:94143341-94143363 CCATGGCTGAACTACTCAATGGG + Intergenic
912151988 1:106870786-106870808 ACTTGGCCAAAACAAGCAATGGG - Intergenic
912278100 1:108282147-108282169 ACTAGCCTGAAACCCTCAAGTGG - Intergenic
912290126 1:108412210-108412232 ACTAGCCTGAAACCCTCAAGTGG + Intronic
912681895 1:111734091-111734113 ACTTGGCTGGAACTCTCAACAGG + Intronic
913655476 1:120955886-120955908 ACGTGAGTGAAACACACAATGGG - Intergenic
915769763 1:158408126-158408148 CCTTGGCTGAAACAGTGATTAGG - Intergenic
918280564 1:183000797-183000819 ACTAGGCTGAATTTCTCAATTGG - Intergenic
919137531 1:193529480-193529502 ACTTCTCAGAAACACTGAATTGG - Intergenic
922483295 1:225954653-225954675 ACATGGCTGAAATTCACAATGGG - Intergenic
922701594 1:227764345-227764367 ACTTTGCTTAAACACTCAGAAGG - Intronic
1063790451 10:9439713-9439735 ACTCAGCTGCAATACTCAATTGG + Intergenic
1066040437 10:31543916-31543938 ACTTGGCTGTAGCACAGAATGGG - Intergenic
1066991332 10:42517060-42517082 ACTGGCCTGAAAAACTGAATTGG + Intergenic
1071340828 10:84646650-84646672 ACCTGACTGAAACAAGCAATGGG - Intergenic
1074024178 10:109616545-109616567 ACTTTGCTGAATCACTTGATCGG - Intergenic
1078331044 11:10421377-10421399 ACTTGACAGAAACAAGCAATGGG - Intronic
1078429326 11:11275798-11275820 ACCTGACTGAAACAAGCAATGGG - Intronic
1079079763 11:17406102-17406124 ACTTGGCTTAAAAACACAACAGG - Intronic
1081838975 11:46181995-46182017 AATGGGCTCATACACTCAATGGG + Intergenic
1085473088 11:76770592-76770614 ACTTAGCTGAAGCTCACAATGGG - Intergenic
1087670940 11:101105952-101105974 ACTTGACTCAAACAAGCAATGGG + Intronic
1091703033 12:2676551-2676573 ACCTGGCACAAAAACTCAATCGG + Intronic
1095041697 12:37449574-37449596 ACTTTGCTGAAACAAGCAATGGG + Intergenic
1097616406 12:61889274-61889296 TCTTGACTGCAATACTCAATAGG - Intronic
1106309485 13:28541601-28541623 ATGTGGCAGAAACACACAATGGG - Intergenic
1107199710 13:37699480-37699502 ACAAGGCTGAAAAACTTAATTGG - Intronic
1109767714 13:66927120-66927142 ACTTGTCTGAAACTGTAAATTGG - Intronic
1113444672 13:110356227-110356249 TCTCTGATGAAACACTCAATGGG + Intronic
1113967166 13:114160005-114160027 ACTTGACTAAAACATGCAATGGG - Intergenic
1115018331 14:28643863-28643885 ACCTGGCAGAAACAAGCAATGGG + Intergenic
1115605658 14:34999356-34999378 ACTTGGGTGTAAAACTAAATGGG + Intronic
1117207903 14:53463502-53463524 AATTGCCTGAAACTCTCAAGTGG + Intergenic
1117550676 14:56833036-56833058 AATTGGCTGAAGCACAGAATAGG + Intergenic
1118902238 14:69996104-69996126 TTTTGGCTGAAACACTCACTTGG + Intronic
1120151741 14:81043811-81043833 ACTTGGCAAAAACAAGCAATGGG + Intronic
1121140385 14:91536622-91536644 GCCTGGATGAAACACTCCATGGG - Intergenic
1125207702 15:37173501-37173523 ACTTGGCACAAACAAGCAATGGG - Intergenic
1126420409 15:48466438-48466460 ACTTGGATGAAAGAATTAATGGG - Intronic
1126562840 15:50062528-50062550 ACATGGCTGATAAACCCAATTGG + Intronic
1136089051 16:27905268-27905290 ACTTGGCTGGACCACACAAAGGG + Intronic
1140412965 16:74752618-74752640 ACCTGGCTGAGACACTCATGGGG - Intronic
1140437757 16:74962055-74962077 ACTTGACAAAAACAATCAATGGG - Intronic
1140886111 16:79244942-79244964 ACCTGGCAAAAACAATCAATGGG + Intergenic
1141403662 16:83772945-83772967 ACTCTGCTGAAACAAACAATGGG + Intronic
1142943651 17:3405680-3405702 ACTTGGCAAAAACAAGCAATGGG - Intergenic
1144635182 17:16902295-16902317 ACTTGGCAAAAACAAGCAATGGG + Intergenic
1150424616 17:65067429-65067451 GCTCGGCTGAAACACTGCATTGG + Intergenic
1150756055 17:67915162-67915184 ACTTGTCTCATACACTCAATAGG + Intronic
1153974577 18:10257030-10257052 ACTTGACAGAAACAAGCAATGGG + Intergenic
1155448414 18:25937331-25937353 ACTTGACCAAAACAATCAATGGG - Intergenic
1161572668 19:5038967-5038989 ACTTGGCTGAGACCCACTATGGG - Intronic
1162728405 19:12703202-12703224 AGTTGGCTAAAAGACTCATTCGG - Intronic
925200126 2:1960590-1960612 ATGTGGCTGAAACACTCAGCAGG - Intronic
929051402 2:37839887-37839909 CCTTGGGTGAATCACTGAATAGG + Intergenic
929621605 2:43360183-43360205 ACTTATCTGAACCACTCATTTGG + Intronic
931800607 2:65754447-65754469 ACTTGGATGACCCACTGAATTGG + Intergenic
933282486 2:80347169-80347191 ACTAGGCTGACACCTTCAATTGG + Intronic
936667804 2:114617706-114617728 ACTTAGCCCAAACACTCAGTGGG + Intronic
939345392 2:140959335-140959357 AGTTGACTGAAAAACTGAATAGG + Intronic
940491183 2:154363166-154363188 TCTTGGCTTAAAAACCCAATAGG + Intronic
941466657 2:165836186-165836208 GCTTAGATGAAACACTCATTTGG + Intergenic
943160036 2:184235782-184235804 ACTTTGCTTAAAGTCTCAATAGG + Intergenic
944246473 2:197535405-197535427 ACTTGGGTTATACACTAAATAGG - Intronic
1176013743 20:62916692-62916714 TTTTAGCTGAAACACTCTATGGG - Intronic
960771615 3:121198750-121198772 ACTTGGCAAAAACAAGCAATGGG - Intronic
962811220 3:138960838-138960860 ACTTGGCTGAAAGTGACAATGGG - Intergenic
963432623 3:145229106-145229128 ACTTTGCTGAATCACATAATGGG - Intergenic
964878678 3:161399277-161399299 ACCTGGCAAAAACAATCAATGGG + Intergenic
964965350 3:162485686-162485708 ACTTGGCTGATAGGCACAATAGG + Intergenic
967580416 3:191146613-191146635 ACCTGGCAAAAACAATCAATGGG - Intergenic
969546163 4:7829703-7829725 AGTTGGCTAACACACTCTATTGG + Intronic
970674492 4:18433087-18433109 AATTGGCTGATTGACTCAATGGG + Intergenic
972052390 4:34754564-34754586 ACATTGCTGAAACTGTCAATTGG + Intergenic
972274647 4:37545712-37545734 ACTGAGCTGAAACAATGAATGGG - Intronic
974341320 4:60617790-60617812 ACTTCACTGAAAAGCTCAATAGG + Intergenic
974777329 4:66502190-66502212 ACTTGGCTGAAAAACAAATTGGG - Intergenic
978806909 4:112810420-112810442 ACTTGGCTGGAAAACACACTGGG - Intergenic
978822800 4:112985241-112985263 AGTTTGCTGACACACTCAACTGG - Intronic
982374742 4:154677517-154677539 ACTTGACTGAAACTGTCAAGTGG - Intronic
985881710 5:2643276-2643298 ACTTTGCTGAAGCTCTCAACAGG + Intergenic
990422096 5:55646051-55646073 ACTTGGGCGAAGCACTCAAAAGG + Intronic
991440952 5:66648557-66648579 TCTTGGGTAAAAAACTCAATAGG - Intronic
992169021 5:74084063-74084085 CCTTGGCTGCAACACTATATGGG - Intergenic
992983730 5:82205144-82205166 ACTTCTCTGAAACACTGGATAGG - Intronic
993178046 5:84513994-84514016 ACCTGGCAGAAACAAGCAATGGG - Intergenic
1003411831 6:5871671-5871693 ACTTGGCTGAAACTCTCATGTGG + Intergenic
1004919840 6:20366325-20366347 AATTGGGTGAAACAGTCAACTGG + Intergenic
1007157795 6:39762786-39762808 ACCTGACTGAAACAAGCAATGGG - Intergenic
1008482978 6:52005998-52006020 ACTTGGCTGTACCCCTCAATGGG + Intronic
1011301041 6:85874179-85874201 ACTTGACAAAAACATTCAATGGG - Intergenic
1011611385 6:89154663-89154685 TATTGGCTGAAAAACTTAATGGG + Intronic
1013726902 6:113109234-113109256 ACTTGACAAAAACAATCAATGGG - Intergenic
1021658660 7:22896934-22896956 ATATGGCAGAAACAATCAATGGG + Intergenic
1022057646 7:26756118-26756140 ACTTGGTTGAAAAACACAAGTGG + Intronic
1022750564 7:33219731-33219753 ACTTGGCTCTACCAATCAATAGG + Intronic
1023747413 7:43334062-43334084 ACTTGGCTGAAACACTCAATAGG - Intronic
1026384150 7:69829117-69829139 ACTTGGCCAAAACAAGCAATGGG + Intronic
1029515466 7:101020600-101020622 ACTTGGCGGGAACATTCACTGGG - Intronic
1030379251 7:108793637-108793659 ACTTTTCTGTTACACTCAATGGG - Intergenic
1031054439 7:116978087-116978109 GCTTGGCTGAATCATTCCATGGG + Intronic
1035362764 7:158324469-158324491 ACTTGGATGAAAGACTCACTGGG + Intronic
1036627685 8:10484998-10485020 ACTTGGCTGAGAATCTAAATTGG - Intergenic
1039678623 8:39702749-39702771 ACTTGACAGAAACAAACAATGGG - Intronic
1042385220 8:68166238-68166260 ACTCACCTGAAACACCCAATAGG + Intronic
1044122974 8:88420657-88420679 ACTGTGCTGAAACACTTCATTGG + Intergenic
1044154805 8:88831491-88831513 AATTGGATGCAACATTCAATTGG - Intergenic
1044278061 8:90324901-90324923 ACTGGGCTGAAATGCTCAAGTGG + Intergenic
1045019774 8:98031885-98031907 ACTTGCATGAAACAATCAAGAGG - Intronic
1051709335 9:19914203-19914225 AGGTGGTTGAAACACTCAAGTGG - Intergenic
1053592346 9:39526927-39526949 ACTTTGCTGAGAGCCTCAATTGG + Intergenic
1053850194 9:42282269-42282291 ACTTTGCTGAGAGCCTCAATTGG + Intergenic
1054573955 9:66838352-66838374 ACTTTGCTGAGAGCCTCAATTGG - Intergenic
1058265265 9:102890879-102890901 ACTTGGCTGACACAATAAATAGG + Intergenic
1059353539 9:113682966-113682988 ACTTGGCTGAAACCCACAATGGG + Intergenic
1059379887 9:113914841-113914863 ACTTGGATGTAACAGTCAGTAGG + Intronic
1061344229 9:130009318-130009340 ACTTGCATGAAAAACTCTATGGG + Intronic
1188336955 X:28947956-28947978 ACATGGCTGAAACATTAAAGAGG + Intronic
1193989167 X:88284840-88284862 ACTTGGATAAAACTCTCCATTGG - Intergenic
1194161368 X:90457189-90457211 ACTTGGCTCACACACTCACAAGG - Intergenic
1194161376 X:90457253-90457275 ACTTGGCTCACACACTCACAAGG + Intergenic
1194233396 X:91351785-91351807 AGTTGGCTAAAACAAGCAATGGG + Intergenic
1196720600 X:118850122-118850144 ACTTAGTTGAAACACTCCCTGGG - Intergenic
1198019521 X:132644494-132644516 ACATGGGGGAAACACTGAATTGG - Intronic
1200293818 X:154897258-154897280 ACATGCCTGACACACACAATTGG + Intronic