ID: 1023747415

View in Genome Browser
Species Human (GRCh38)
Location 7:43334079-43334101
Sequence GCTATGCACAACCATTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023747415_1023747417 -3 Left 1023747415 7:43334079-43334101 CCAAGTCAATGGTTGTGCATAGC 0: 1
1: 0
2: 0
3: 11
4: 72
Right 1023747417 7:43334099-43334121 AGCCACAGCTGTTTTTGGTGAGG No data
1023747415_1023747419 11 Left 1023747415 7:43334079-43334101 CCAAGTCAATGGTTGTGCATAGC 0: 1
1: 0
2: 0
3: 11
4: 72
Right 1023747419 7:43334113-43334135 TTGGTGAGGACAGAGATCTGTGG No data
1023747415_1023747416 -8 Left 1023747415 7:43334079-43334101 CCAAGTCAATGGTTGTGCATAGC 0: 1
1: 0
2: 0
3: 11
4: 72
Right 1023747416 7:43334094-43334116 TGCATAGCCACAGCTGTTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023747415 Original CRISPR GCTATGCACAACCATTGACT TGG (reversed) Intronic
903011205 1:20331703-20331725 GCCATGCTGAATCATTGACTTGG + Intronic
905513389 1:38542412-38542434 GCTATTCCCAACGATTGGCTTGG - Intergenic
909347104 1:74603228-74603250 ACTATCCACAACCATTTAGTGGG + Intronic
910051883 1:82984529-82984551 CCTATGCACAACAATGGACTAGG + Intergenic
910819940 1:91335852-91335874 GCCATGCTCAGTCATTGACTGGG - Intronic
915918700 1:159958133-159958155 GCTGTGCACAGCCATGGGCTGGG + Intergenic
919129267 1:193433120-193433142 GCTATGTACAGCCTTAGACTTGG - Intergenic
921959916 1:221023852-221023874 TCTATGTACAGCCATTCACTTGG + Intergenic
1068901765 10:62277551-62277573 GCTATGAAGAACAATGGACTGGG + Intergenic
1070742155 10:78910289-78910311 GCATTTCACAACCATTGACTAGG - Intergenic
1071990791 10:91099030-91099052 GCTTTGCCCAGCCATTGTCTAGG - Intergenic
1076180984 10:128407309-128407331 GCTATGCACCATCACTGCCTTGG + Intergenic
1079879024 11:25900219-25900241 CCCATGCACAAGCATTTACTAGG + Intergenic
1080596970 11:33781701-33781723 GCCATGCTCAGCCATTGGCTAGG + Intergenic
1082789662 11:57338588-57338610 GCTCTTCACAACCACCGACTTGG - Exonic
1084742165 11:71146863-71146885 TCCATCCACAAACATTGACTGGG - Intronic
1086374225 11:86183997-86184019 GCTATGCACAAACAGTGAGGAGG + Intergenic
1090183588 11:124721523-124721545 GCTATGCACAGCCATTCTTTGGG - Intergenic
1094093684 12:26678973-26678995 GATATGCACAGCAATTTACTTGG - Intronic
1096789494 12:54036002-54036024 GCTATGCAGGACAATTAACTGGG + Intronic
1099877417 12:88425867-88425889 TCTAAGCACTAACATTGACTAGG + Intergenic
1101286458 12:103318375-103318397 GATATGCACACCCCATGACTTGG - Intronic
1101748037 12:107559010-107559032 GCTCTGCACAAGCAGGGACTGGG + Intronic
1102412661 12:112733596-112733618 GCCATGCCCAGTCATTGACTGGG + Intronic
1107150319 13:37104122-37104144 GCTGTGAACAACCATTTAGTTGG - Exonic
1110815019 13:79851775-79851797 GCTATGCAAAAATATTGAATCGG - Intergenic
1113529615 13:111012812-111012834 GCTAGGCACCACTAGTGACTGGG - Intergenic
1118075559 14:62294905-62294927 GATATGCATAACCTTTGACCTGG + Intergenic
1123166531 14:106330563-106330585 ACTGTGCACAGCCATTGTCTGGG - Intergenic
1123194191 14:106600822-106600844 ACTGTGCACAGCCATTGTCTGGG - Intergenic
1123199793 14:106651679-106651701 ACTGTGCACAGCCATTGTCTGGG - Intergenic
1123222132 14:106867101-106867123 GCTGTGCACAGCCATTGTCTGGG - Intergenic
1123488304 15:20760446-20760468 GCTGTGCACAGCCATTAGCTGGG - Intergenic
1123544802 15:21329519-21329541 GCTGTGCACAGCCATTAGCTGGG - Intergenic
1124706849 15:31973700-31973722 GCTGTGCACAGCCTTTGCCTGGG + Intergenic
1125171573 15:36771481-36771503 GCTGTGCACCACAATTGGCTGGG - Intronic
1128337702 15:66798023-66798045 GCTTTGCACGAGCATTGACTTGG - Intergenic
1202953147 15_KI270727v1_random:56790-56812 GCTGTGCACAGCCATTAGCTGGG - Intergenic
1134400729 16:13907399-13907421 TCTAGGCAAAACCATTAACTAGG - Intergenic
1147315747 17:39619241-39619263 GCTTTGCAGGGCCATTGACTGGG + Intergenic
1151955684 17:77379083-77379105 GCTCTGCACCACACTTGACTGGG - Intronic
1159450797 18:68599503-68599525 ACTATGCACCACCATTTATTGGG - Intergenic
925064874 2:922081-922103 GCTAAGCACAGCCATGGACCGGG - Intergenic
927406651 2:22777929-22777951 GCTATCCACAAACAGTGACAGGG - Intergenic
936161963 2:110090109-110090131 GCTATAAACAACCAGAGACTGGG - Intronic
936182700 2:110281245-110281267 GCTATAAACAACCAGAGACTGGG + Intergenic
1169413219 20:5392489-5392511 GATATGCACACCCATCGCCTGGG + Intergenic
1173642969 20:44616374-44616396 TCAATGAACAGCCATTGACTCGG - Intronic
1176080480 20:63270191-63270213 GCTCTGCACAGCCATTTACTAGG + Intronic
1178479678 21:32968706-32968728 GCTCTGTCCAACCCTTGACTTGG - Intergenic
1180018390 21:45102849-45102871 GCTCTGCACAGCCCTTGCCTTGG - Intronic
1182491638 22:30676203-30676225 GATGTGTACAACCATGGACTGGG - Intergenic
957678232 3:83397912-83397934 GCTATGCACTAACAGTGACCAGG + Intergenic
960610377 3:119549927-119549949 GCTATCCATCTCCATTGACTTGG + Intronic
962237542 3:133719341-133719363 ACTATGGACAACCATTGTTTGGG - Intergenic
962378866 3:134880700-134880722 GCTCTGCCCAAGCATTGGCTGGG - Intronic
962933304 3:140057183-140057205 GCAATGCACATCCAATGACATGG + Intronic
964656542 3:159073178-159073200 GCTATGCTCAATCACTGGCTGGG + Intronic
967445706 3:189564159-189564181 GTCATTCACAACCATTCACTTGG - Intergenic
968979784 4:3840958-3840980 GCTATGCAGGACCAGGGACTGGG + Intergenic
976137378 4:81953289-81953311 ACTTTGCAAAACCATTTACTGGG - Intronic
977875980 4:102150523-102150545 GAGATGCACCACCCTTGACTGGG - Intergenic
984048322 4:174830741-174830763 GCTCTGCTTAACCACTGACTGGG + Intronic
986197660 5:5552962-5552984 GTTATGCACTAACACTGACTCGG + Intergenic
987923096 5:24308834-24308856 GATGTGTACAACCATGGACTGGG - Intergenic
993744515 5:91580336-91580358 GCTATACACAACTAGTGACTGGG - Intergenic
994828511 5:104746957-104746979 CCTATGCTCAGCCATTGGCTGGG - Intergenic
999160806 5:149496731-149496753 GTTGTGGACAACCATTTACTTGG - Intronic
1013065776 6:106683497-106683519 GCTATGCTCAACCAGTGCTTTGG + Intergenic
1015748104 6:136532562-136532584 GCTGTGCACAAACACTGATTTGG + Intronic
1023376482 7:39561185-39561207 GCTATGCTCAATCATTGGCTGGG - Intergenic
1023747415 7:43334079-43334101 GCTATGCACAACCATTGACTTGG - Intronic
1025772065 7:64518267-64518289 GCTATACACCAACAGTGACTGGG + Intergenic
1032029631 7:128472120-128472142 GCTAATTATAACCATTGACTCGG + Intergenic
1032596800 7:133249376-133249398 TCTATTCACATCCATTGCCTAGG + Intergenic
1042264368 8:66893099-66893121 GATATGGACAGCCATGGACTGGG + Intronic
1048173142 8:132127652-132127674 ACTATCCACAACCAGTGCCTAGG + Exonic
1054726300 9:68654568-68654590 GCTATGGATGACCATTGTCTAGG - Intergenic
1058319941 9:103616194-103616216 GCTGTTCTCAAACATTGACTGGG + Intergenic
1060379541 9:123154094-123154116 GGTATGTGCAACCATTTACTAGG + Intronic
1188774555 X:34198190-34198212 GCTATGCTCAATCACTGACTAGG - Intergenic
1189233414 X:39469837-39469859 GCCATGCACAGTCATTGACTGGG - Intergenic
1192629907 X:72769312-72769334 CCTCTGCAAAACCATTGACTAGG + Intergenic
1192651803 X:72951492-72951514 CCTCTGCAAAACCATTGACTAGG - Intergenic