ID: 1023747419

View in Genome Browser
Species Human (GRCh38)
Location 7:43334113-43334135
Sequence TTGGTGAGGACAGAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023747415_1023747419 11 Left 1023747415 7:43334079-43334101 CCAAGTCAATGGTTGTGCATAGC 0: 1
1: 0
2: 0
3: 11
4: 72
Right 1023747419 7:43334113-43334135 TTGGTGAGGACAGAGATCTGTGG No data
1023747413_1023747419 28 Left 1023747413 7:43334062-43334084 CCTATTGAGTGTTTCAGCCAAGT 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1023747419 7:43334113-43334135 TTGGTGAGGACAGAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023747419 Original CRISPR TTGGTGAGGACAGAGATCTG TGG Intronic
No off target data available for this crispr